Sequence ID: | GBAR002-24.COI-5P | GenBank Accession: | |
---|---|---|---|
Primers Forward: | Primers Reverse: | ||
Sequence Run Site: | Senckenberg Deutsches Entomologisches Institut | ||
TATTCTTTATTTTTTATTTGCTATTTGAGCTGGAATAATTGGATCTTCAATAAGAATGATTATTCGATTAGAACTAGGATCATGTGATTCAATTATTAATAATGATCAAATTTATAACACTTTAGTAACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCTTTAATATTAGGAACCCCAGATATAGCCTATCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTATTATATTATTATTATTTAGAAGATTTATTAATATAGGAGTAGGTACTGGATGAACTATTTATCCTCCATTAGCTTCAAATATTTTTCATAGAGGACCCTCAGTAGATATATCGATTTTTTCCCTTCATATTGCAGGTATATCATCCATTTTAGGAGCTATTAATTTTATTTCTACTATTTTAAATATACATCATAAAAAACTATCTTTAGATAAAATTCCATTATTAGTATGGTCTATTTTAATTACAGCCATTTTATTATTATTATCCTTACCAGTATTAGCCGGAGCTATTACTATACTTCTAACAGATCGAAACTTAAACACTTCATTCTTTGATCCTTCTGGGGGAGGAGACCCAATCTTATATCAACATTTATTT | |||
Locus: | COI-5P | ||
Nucleotides: | 658 bp | ||
Sequence Upload Date: | 2024-09-10 |
Specimen Depository: | Senckenberg Deutsches Entomologisches Institut |
---|---|
Sequencing Center: | Senckenberg Deutsches Entomologisches Institut |
Photography: | Elias Freyhof |
Collectors: | Elias Freyhof |
Specimen Identification: | Elias Freyhof |
Process ID: | GBAR002-24 | Sample ID: | DEI-GISHym5391 | |||
---|---|---|---|---|---|---|
Record Created: | 2024-08-30 | Museum ID: | DEI-GISHym5391 | |||
Collection Code: | DEI-GISHym5391 | Field ID: | DEI-GISHym5391 | |||
Deposited In: | Senckenberg Deutsches Entomologisches Institut | |||||
Associated Datasets: | DS-GBAR | Introduced greenhouse-invertebrates in Potsdam and Berlin with a focus on ants (Hymenoptera, Formicidae) with eight new records for Europe, Germany or the Berlin-Brandenburg region | |||||
Specimen Linkout: | ||||||
Checksum: | ab4ff9745462a26c723ef54c1e7ff355 |
Kingdom: | Animalia | Subfamily: | Myrmicinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | Crematogastrini |
Class: | Insecta | Genus: | Tetramorium |
Order: | Hymenoptera | Species: | Tetramorium bicarinatum |
Family: | Formicidae | Scientific Name Authorship: | Nylander, 1846 |
BIN ID: | BOLD:AAA5578 | Subspecies: | |
Identification Method: | Morphology | ||
Taxonomy Notes: | High Confidence in identification | ||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Reproduction: | S | |
---|---|---|---|
Tissue Descriptor: | whole body | Sex: | F |
Brief Note: | Life Stage: | Adult | |
Detailed Notes: | specimens from one nest |
Country/Ocean: | Germany (DE) | Collection Date Start: | 2023-11-22 |
---|---|---|---|
Province/State: | Berlin | Collection Date End: | |
Region/County: | Berlin | Coord. Source: | smartphone |
Sector: | Coord. Accuracy: | 11 | |
Exact Site: | Botanical Garden Berlin | Elevation: | |
Habitat: | greenhouse | Elevation Accuracy: | |
Latitude: | 52.456 | Depth: | |
Longitude: | 13.308 | Depth Accuracy: | |
Sampling Protocol: | Attractants | ||
Collectors: | Elias Freyhof | ||
Collection Note: |
Realm: | |
---|---|
Biome: | |
Ecoregion: |
http://portal.boldsystems.org/record/GBAR002-24 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGBAR002-24&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGBAR002-24&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ3cgwyMDDSNTKxzsnMzSxJTQEAufcK5Q==?length=1
© 2024 BOLDSYSTEMS