| Sequence ID: | HCNC133-09.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF2_t1 (TGTAAAACGACGGCCAGTAATCATAARGATATYGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Korea Research Institute of Bioscience and Biotechnology | ||
| ATTTTGACTTTTACCCCCATCCCTAACATTATTATTATCCAGAAGAATAGTAGAAATAGGGGCAGGTACAGGATGAACTGTATACCCACCCCTATCTAATAGATTATTTCATAGAGGAGCATCAGTTGACTTAGCAATTTTTTCATTACACCTAGCAGGTATTTCATCAATCTTAGGAGCCATCAACTTCATTTCAACAATTATTAATATACGGCCTGCTGGTATATCCCCAGAACAAATCCCCCTATTCGTTTGATCTGTAGGAATTACAGCCCTACTTTTATTATTATCTTTACCCGTTTTAGCAGGAGCTATCACTATACTATTAACTGATCGAAACTTTAACACATCATTTTTTGATCCTACAGGAGG | |||
| Locus: | COI-5P | ||
| Nucleotides: | 372 bp | ||
| Sequence Upload Date: | 2009-10-06 | ||
| Specimen Depository: | Canadian National Collection of Insects, Arachnids and Nematodes |
|---|---|
| Sequencing Center: | Korea Research Institute of Bioscience and Biotechnology |
| Photography: | CBG Photography Group |
| Collectors: | C. Kassebeer |
| Specimen Identification: | C. N. C. Curators |
| Process ID: | HCNC133-09 | Sample ID: | CNC-HEM-0133 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | |||||
| Collection Code: | Field ID: | CNC-HEM-0133 | ||||
| Deposited In: | Canadian National Collection of Insects, Arachnids and Nematodes | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | b3090f7123e584c210c40597541f1f0a | |||||
| Kingdom: | Animalia | Subfamily: | Rhyparochrominae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Rhyparochromini |
| Class: | Insecta | Genus: | Beosus |
| Order: | Hemiptera | Species: | Beosus maritimus |
| Family: | Rhyparochromidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ABW9272 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Morocco (MA) | Collection Date Start: | 1997-02-19 |
|---|---|---|---|
| Province/State: | Marrakech-Tensift-El Haouz Region | Collection Date End: | |
| Region/County: | Marrakech | Coord. Source: | |
| Sector: | Marokko | Coord. Accuracy: | |
| Exact Site: | Marracech Ourigane | Elevation: | 1000 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 31.1333 | Depth: | |
| Longitude: | -8.08333 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | C. Kassebeer | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Mediterranean_woodlands_and_forests |
http://portal.boldsystems.org/record/HCNC133-09 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AHCNC133-09&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AHCNC133-09&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJw9nM2NDbWNbC0zsnMzSxJTQEAumMK7Q==?length=1
© 2024 BOLDSYSTEMS