Sequence ID: | IBIPP039-20.COI-5P | GenBank Accession: | MT407233 |
---|---|---|---|
Primers Forward: | Primers Reverse: | ||
Sequence Run Site: | Research Center in Biodiversity and Genetic Resources | ||
AACTCTATATTTCATCTTTGGAGCCTGATCCGGTATAGTCGGTACATCACTGAGTTTACTGATTCGAGCAGAATTAGGCCAGCCAGGCTCCTTAATTGGAGATGATCAAATCTATAATGTTATTGTAACAGCACATGCTTTTGTAATAATTTTCTTTATGGTTATACCTATTATAATTGGGGGATTCGGAAACTGACTGGTTCCATTAATATTAGGAGCACCAGATATGGCCTTCCCTCGAATAAACAACATAAGTTTTTGACTATTACCCCCTTCCTTGACCCTATTGTTGGCCAGTAGCCTCGTTGAAAACGGAGCAGGCACTGGTTGAACGGTCTACCCCCCGCTTTCTGCGGGGATTGCCCACGCAGGCGCTTCTGTAGATATAGCTATCTTCTCTCTTCATTTAGCGGGGGTCTCTTCTATTTTGGGTGCTGTAAACTTTATCACTACTGTAATCAATATACGATCTGCAGGGATAACCTTAGATCGTATACCCCTTTTTGTGTGAGCCGTAGCTATTACGGCCCTACTCCTTCTCCTCTCCCTCCCAGTTTTAGCCGGAGCTATCACTATACTCCTAACGGATCGTAATTTAAATACTTCATTTTTCGATCCAGCTGGTGGAGGTGATCCTATTTTATATCAACATCTCTTT | |||
Locus: | COI-5P | ||
Nucleotides: | 658 bp | ||
Sequence Upload Date: | 2020-03-23 |
Specimen Depository: | Research Center in Biodiversity and Genetic Resources |
---|---|
Sequencing Center: | Research Center in Biodiversity and Genetic Resources |
Photography: | |
Collectors: | Lorenzo Quaglietta |
Specimen Identification: | J. M. Tierno De Figueroa |
Process ID: | IBIPP039-20 | Sample ID: | INV00764 | |||
---|---|---|---|---|---|---|
Record Created: | 2020-03-23 | Museum ID: | 12D6 | |||
Collection Code: | Field ID: | G-353 | ||||
Deposited In: | Research Center in Biodiversity and Genetic Resources | |||||
Associated Datasets: | DS-IBIPP01 | IBI-Plecoptera 01 | |||||
Specimen Linkout: | ||||||
Checksum: | ea7a34f8996bf2ed3d5f49482dc5c6c2 |
Kingdom: | Animalia | Subfamily: | Perlinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | |
Class: | Insecta | Genus: | Perla |
Order: | Plecoptera | Species: | Perla madritensis |
Family: | Perlidae | Scientific Name Authorship: | |
BIN ID: | BOLD:AEB9929 | Subspecies: | |
Identification Method: | Morphology | ||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
---|---|---|---|
Tissue Descriptor: | Leg | Sex: | F |
Brief Note: | Life Stage: | Adult | |
Detailed Notes: |
Country/Ocean: | Portugal (PT) | Collection Date Start: | 2015-06-19 |
---|---|---|---|
Province/State: | Collection Date End: | ||
Region/County: | Coord. Source: | Coordinates from country centroid | |
Sector: | Coord. Accuracy: | ||
Exact Site: | Elevation: | ||
Habitat: | Elevation Accuracy: | ||
Latitude: | 39.675293 | Depth: | |
Longitude: | -7.9336624 | Depth Accuracy: | |
Sampling Protocol: | |||
Collectors: | Lorenzo Quaglietta | ||
Collection Note: |
Realm: | Palearctic |
---|---|
Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
Ecoregion: | Southwest_Iberian_Mediterranean_sclerophyllous_and_mixed_forests |
http://portal.boldsystems.org/record/IBIPP039-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AIBIPP039-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AIBIPP039-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJ08gwIMDC21DUysM7JzM0sSU0BAMYpC0M=?length=1
© 2024 BOLDSYSTEMS