| Sequence ID: | OLICH4182-17.ITS | GenBank Accession: | MK812320 |
|---|---|---|---|
| Primers Forward: | ITS5 (GGAAGTAAAAGTCGTAACAAGG) | Primers Reverse: | ITS4 (TCCTCCGCTTATTGATATGC) |
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| atcattgaatctattatattgtctacctgctaacctggtcgttatgttccctcggtgcgggcccctcgtgggaccgcccgggcgcttgttcctggcccagccactggccgacctcgctgtcggtgaagactgggacaaggtcttgcggtgcgggcttcggctcgctggacgaaatctcaccccacacaccaaacacatacataagctgaagctcgagtgccgcttcgaaagaggtgcctcactaacctagacaactctcaacaacggatatcttggctcccgcaacgatgaagaacgcagcgaaatgcgatacttaatgtgaattgcagaattccgtgaatcatcgagtttttgaacgcatattgcgcccaaggcttcggccgagggcatgcctgcctcagcgtcggttgacccctctcgtttttcctcggaaggacggacctggcggtcccgctggagacagcgggtccactgcagagcagacgacgtgcagcctcgcttacgcagaggccgctggactggtaggttcgtttcgaacatgccgtcgagcggctgggcaagacaactgcacgtcccaaccacactcactcatatttcgacctgagttcaggcaagaccacccgctcaacttaa | |||
| Locus: | ITS | ||
| Nucleotides: | 633 bp | ||
| Sequence Upload Date: | 2019-03-19 | ||
| Specimen Depository: | University of Oslo, Natural History Museum |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Einar Timdal |
| Collectors: | Einar Timdal |
| Specimen Identification: | Einar Timdal |
| Process ID: | OLICH4182-17 | Sample ID: | O-L-201401 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2017-11-20 | Museum ID: | O-DFL-7632 | |||
| Collection Code: | L | Field ID: | ||||
| Deposited In: | University of Oslo, Natural History Museum | |||||
| Associated Datasets: | DS-OLICH | DNA barcodes of Nordic lichens | |||||
| Specimen Linkout: | ||||||
| Checksum: | 67b2a84ec1302a6eeb92319c780a14ac | |||||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Thallus | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Chemistry: anziaic acid, atranorin, miriquidic acid, perlatolic acid | ||
| Country/Ocean: | Norway (NO) | Collection Date Start: | 2015-09-09 |
|---|---|---|---|
| Province/State: | Oppland | Collection Date End: | |
| Region/County: | Vang | Coord. Source: | |
| Sector: | Coord. Accuracy: | 9 | |
| Exact Site: | canyon near Hagaslettene | Elevation: | 950 |
| Habitat: | On rock wall | Elevation Accuracy: | |
| Latitude: | 61.0263 | Depth: | |
| Longitude: | 8.66883 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Einar Timdal | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Scandinavian_Montane_Birch_forest_and_grasslands |
http://portal.boldsystems.org/record/OLICH4182-17 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AOLICH4182-17&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AOLICH4182-17&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfL38XT2MDG0MNI1NLfOyczNLElNAQDQMwt3?length=1
© 2024 BOLDSYSTEMS