| Sequence ID: | ABWYT10515-24.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTTATATTTTGTATTTGGAACATGAGCTGGTATAGTAGGAACTTCATTAAGAATTTTAATTCGAGCTGAATTAGGACATCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGTTTCTGATTATTACCTCCTTCTTTAACTTTATTATTAGTAAGAAGTATAGTAGAAAATGGGGCTGGAACGGGATGAACTGTTTACCCTCCTCTATCTAGTAATATTGCACATGGAGGAGCTTCAGTTGATTTAGCAATTTTTTCACTTCATTTATCTGGTATATCATCAATTTTAGGTGCAGTAAATTTTATTACCACAATTATTAATATACGATCAACAGGAATTACATATGATCGAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCTTTATTACTTTTACTTTCTTTACCAGTTCTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 653 bp | ||
| Sequence Upload Date: | 2024-03-06 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | CBG Robotic Rig |
| Collectors: | S. Cannings |
| Specimen Identification: | BOLD Identification System [2025] |
| Process ID: | ABWYT10515-24 | Sample ID: | CBG-A27572-B02 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2024-01-23 | Museum ID: | CBG-A27572-B02 | |||
| Collection Code: | BIOUG | Field ID: | GMP#47103 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: | DS-ARCBIOY6 | ARCBIO - Arctic BIOSCAN - Year 6 | |||||
| Specimen Linkout: | ||||||
| Checksum: | 75789200c38b9faee1660a352aaf0b5c | |||||
| Kingdom: | Animalia | Subfamily: | Eristalinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Eristalini |
| Class: | Insecta | Genus: | Eristalis |
| Order: | Diptera | Species: | Eristalis anthophorina |
| Family: | Syrphidae | Scientific Name Authorship: | Fallen, 1817 |
| BIN ID: | BOLD:AAB6090 | Subspecies: | |
| Identification Method: | Other sequence based approach | ||
| Taxonomy Notes: | id-date: Nov 2025 | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv leg | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2023-07-15 |
|---|---|---|---|
| Province/State: | Yukon | Collection Date End: | 2023-07-23 |
| Region/County: | Whitehorse | Coord. Source: | |
| Sector: | Crestview | Coord. Accuracy: | |
| Exact Site: | Hillside spring meadow | Elevation: | 762 |
| Habitat: | 4. Native Grassland|4.2 Subarctic Grassland | Elevation Accuracy: | |
| Latitude: | 60.7884 | Depth: | |
| Longitude: | -135.1875 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | S. Cannings | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | Boreal_Forest_Taiga_simplify-0.1_buffered-0.018 |
| Ecoregion: | Watson_Highlands_taiga |
http://portal.boldsystems.org/record/ABWYT10515-24 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AABWYT10515-24&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AABWYT10515-24&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ0Co8MMTQwNTTVNTKxzsnMzSxJTQEA21sLug==?length=1
© 2024 BOLDSYSTEMS