| Sequence ID: | AFLAR004-20.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | BirdF1 (TTCTCCAACCACAAAGACATTGGCAC) | Primers Reverse: | BirdR2 (ACTACATGTGAGATGATTCCGAATCCAG) |
| Sequence Run Site: | Royal Museum for Central Africa | ||
| GTGATACCAATCATGATCGGTGGATTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCTGATATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTATTACCCCCATCATTCCTACTCCTCCTAGCCTCTTCCACAGTAGAAGCTGGAGCCGGCACAGGATGAACAGTATACCCCCCTCTAGCTGGCAATCTAGCTCATGCTGGAGCCTCAGTAGACCTAGCAATCTTCTCTCTTCACTTAGCAGGTGTGTCCTCCATTCTGGGTGCTATCAACTTTATCACTACAGCCATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACCCCACTATTCGTATGATCCGTACTCATCACTGCCGTCCTATTACTACTTTCACTCCCAGTGCTTGCCGCAGGCATTACTATGCTACTCACAGACCGAAACCTAAACACAACGTTCTTCGATCCCGCCGGAGGCGGTGACCCTGTACTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATATATCCTAATCCT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 536 bp | ||
| Sequence Upload Date: | 2020-02-17 | ||
| Specimen Depository: | Royal Museum for Central Africa |
|---|---|
| Sequencing Center: | Royal Museum for Central Africa |
| Photography: | |
| Collectors: | Alain Reygel |
| Specimen Identification: | Alain Reygel |
| Process ID: | AFLAR004-20 | Sample ID: | Larus_004 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2020-02-13 | Museum ID: | ||||
| Collection Code: | Field ID: | AReygel_4 | ||||
| Deposited In: | Royal Museum for Central Africa | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 3ce36741182871e9fbabf896e3da3f97 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Chordata | Tribe: | |
| Class: | Aves | Genus: | Larus |
| Order: | Charadriiformes | Species: | Larus canus |
| Family: | Laridae | Scientific Name Authorship: | Linnaeus, 1758 |
| BIN ID: | BOLD:ACE9128 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | feather core tip | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Belgium (BE) | Collection Date Start: | 2005-06-09 |
|---|---|---|---|
| Province/State: | Antwerpen (Antwerp) | Collection Date End: | |
| Region/County: | Vosselaar | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | Alain Reygel | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/AFLAR004-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AAFLAR004-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AAFLAR004-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ083EMMjAw0TUysM7JzM0sSU0BAMTXCy0=?length=1
© 2024 BOLDSYSTEMS