| Sequence ID: | AGAKJ438-17.COI-5P | GenBank Accession: | MG348913 |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TTTTTATTTGGTATTTGATCAGGAATAGTAGGATCTGCTCTTAGATTAATTATTCGATTAGAAGTAGGAACTACTAGAAATTTAATTGGTAATGATCAAATTTATAACTCAATTGTTACTGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCATTAATATTAGGAGGATTTGGTAACTGATTAATCCCTTTAATATTATCAGCTCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTCTTTTAATTTATAGAAATATTTTTAGAATAGGAACAGGAACAGGATGAACAGTTTATCCTCCATTATCATTATTAACTAATTCTTCTATTGATGTAAGAATTTTTTCTCTACATTTAGCTGGAATTTCTTCTATTTTAGGATCAATTAATTTTATTTGTACTATTTTAAATATATACCCAATAAATTTTAAAAAAGAAATAAATTCTTTATTTATTTGATCAATTTTTATTACAACTATTTTACTACTATTATCATTACCAGTATTAGCAGGA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 546 bp | ||
| Sequence Upload Date: | 2017-02-22 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | BIO Collections |
| Specimen Identification: | BOLD Identification System [2017] |
| Process ID: | AGAKJ438-17 | Sample ID: | BIOUG31866-B07 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2017-02-06 | Museum ID: | BIOUG31866-B07 | |||
| Collection Code: | BIOUG | Field ID: | GMP#07673 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DS-20GMP01 | GMP 2020 Release Batch 1 DS-OLOCC1 | Other Locatlities Other Collections Canada DS-ZZGGBN22 | GGBN Data Release 22 |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 41ea23ee7b353c28600fd51acc4440bc | |||||
| Kingdom: | Animalia | Subfamily: | Platygastrinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Leptacis |
| Order: | Hymenoptera | Species: | |
| Family: | Platygastridae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ABZ8208 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Whole Voucher | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2015-06-26 |
|---|---|---|---|
| Province/State: | Ontario | Collection Date End: | 2015-07-03 |
| Region/County: | Guelph | Coord. Source: | |
| Sector: | Arkell Research Station | Coord. Accuracy: | |
| Exact Site: | Elevation: | 343 | |
| Habitat: | 14. Artificial - Terrestrial|14.1 Arable Land | Elevation Accuracy: | |
| Latitude: | 43.5187 | Depth: | |
| Longitude: | -80.1705 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | BIO Collections | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Eastern_Great_Lakes_lowland_forests |
http://portal.boldsystems.org/record/AGAKJ438-17 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AAGAKJ438-17&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AAGAKJ438-17&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ0d_T2MjG20DU0t87JzM0sSU0BAMUaCzY=?length=1
© 2024 BOLDSYSTEMS