| Sequence ID: | ANTEU2699-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTCTTTATTTTATTCTTGCTATTTGATCTGGAATAATTGGATCCTCTATAAGTATAATTATTCGACTTGAATTAGGATCATGTAATTCATTAATTAATAATGATCAAATTTATAATACATTAGTAACTAGTCATGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAACTTTTTAGTTCCATTAATATTAGGATCTCCAGATATAGCTTATCCCCGTATAAATAATATAAGTTTCTGACTTCTTCCTCCTTCCCTTTCTCTTCTAATTATAAGAAGCTTTACTAGTAATGGAGTAGGAACAGGATGAACTATTTACCCTCCTTTAGCTTCTAATGTATTCCATTCTGGTACTTCAATTGATTTATCTATTTTTTCACTTCATATTGCTGGTATATCTTCTATTTTAGGAGCTATCAATTTTATTTCTACTATCTTAAATATACATCATATTAATTTAACTATAGAAAAAATTCCTTTATTAGTTTGATCTATTTTAATTACTGCTATTTTACTTTTACTATCTCTACCTGTACTTGCAGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGATCCGTCAGGAGGAGGAGATCCTATTTTATATCAACATCTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 654 bp | ||
| Sequence Upload Date: | 2022-07-20 | ||
| Specimen Depository: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Mattia Menchetti, Institute of Evolutionary Biology |
| Collectors: | Ruano, Francisca & Tinaut, Alberto |
| Specimen Identification: | Alberto Tinaut |
| Process ID: | ANTEU2699-22 | Sample ID: | MM21D051a1 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-06-10 | Museum ID: | ||||
| Collection Code: | Field ID: | MM21D051a1 | ||||
| Deposited In: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 350c27a2b91cfbd62a3edcca55dc1b7c | |||||
| Kingdom: | Animalia | Subfamily: | Myrmicinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Stenammini |
| Class: | Insecta | Genus: | Messor |
| Order: | Hymenoptera | Species: | Messor capitatus |
| Family: | Formicidae | Scientific Name Authorship: | Latreille, 1798 |
| BIN ID: | BOLD:ADT6836 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | Spain (ES) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Cerro Quintana, Sierra de Baza, Granada | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 37.268955 | Depth: | |
| Longitude: | -2.700797 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Ruano, Francisca & Tinaut, Alberto | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Iberian_conifer_forests |
http://portal.boldsystems.org/record/ANTEU2699-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AANTEU2699-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AANTEU2699-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL0C3ENNTKztNQ1MrLOyczNLElNAQDRXwuM?length=1
© 2024 BOLDSYSTEMS