| Sequence ID: | ANZRS438-08.COI-5P | GenBank Accession: | MT021163 |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TAAAGATATTGGTACCCTTTACTTTATCTTAGGGGCCTGGGCTAGAGCTCTCGGCTCCTCTCTCAGAATAATCATCCGATCTGAGCTTAGCTCCCCTGGAAATCTAATTGGAGATGATCAACTATATAATGTTATAGTTACAGCTCACGCCTTTATCATAATTTTTTTCATGGTCATACCTATTATAATCGGAGGTTTCGGTAATTGACTGGTACCCTTAATACTAGGTAGCCCTGACATAGCTTTCCCCCGGATAAATAATATGAGCTTTTGATTGTTGCCTCCCTCTCTAACCCTCCTACTAATAAGAGGCTTAGTTGAAAGAGGAGTAGGTACTGGCTGAACTGTTTACCCTCCTCTAGCTGGCCCCGCCGCCCACAGAGGCGCCTCTGTCGACCTTGCTATTTTTTCACTCCACCTGGCAGGAGCCTCCTCCATTTTAGGTGCTATTAACTTTATCTCAACTGTAATTAATATACGAAGTCCAGGCATAAAATTTGACCAAATCCCGCTATTAGTTTGGTCTGTATTTATTACTGCTATCTTACTCTTACTCTCCTTACCANTACTAGCAGGAGCAATCACCATGCT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 591 bp | ||
| Sequence Upload Date: | 2008-07-18 | ||
| Specimen Depository: | National Institute of Water and Atmospheric Research, Wellington |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | None |
| Collectors: | National Institute of Water and Atmosphere (NZ) |
| Specimen Identification: | Matthew A. Knox |
| Process ID: | ANZRS438-08 | Sample ID: | 31808_02.3 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | |||||
| Collection Code: | Field ID: | 31808_02.3 | ||||
| Deposited In: | National Institute of Water and Atmospheric Research, Wellington | |||||
| Associated Datasets: | DS-ANZCM4 | ANZCM project all taxa | |||||
| Specimen Linkout: | ||||||
| Checksum: | 765da877bee01eddd23636fc2b4d74b8 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Malacostraca | Genus: | |
| Order: | Amphipoda | Species: | |
| Family: | Lysianassidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAG9484 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Oceans 2020 Survey | ||
| Country/Ocean: | New Zealand (NZ) | Collection Date Start: | 2007-04-14 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Chatham Rise | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | -43.512 | Depth: | 196 |
| Longitude: | -176.176 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | National Institute of Water and Atmosphere (NZ) | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/ANZRS438-08 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AANZRS438-08&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AANZRS438-08&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL0iwoKNjG20DWwsM7JzM0sSU0BAMg3C2Y=?length=1
© 2024 BOLDSYSTEMS