| Sequence ID: | ARONZ443-19.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTGTATTTGGTATTTGGGGCTTGGTCTGCTATAGTTGGAACAGCTATAAGAGTTCTTATTCGGATTGAGTTAGGTCAACCTGGTAGATTTTTGGGTGATGATCATTTATATAATGTTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATGATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTGGGAGCTCCAGATATAGCTTTCCCTCGTATAAATAATTTAAGTTTTTGATTATTACCGCCTTCTTTGATTATATTATTTATTTCTTCTATAGTTGAGATAGGTGTTGGGGCTGGGTGAACTATTTATCCTCCTTTAGCTTCTTCTATTGGTCATTTTGGTAGATCTGTTGATTTTGCTATTTTTTCTTTACATTTGGCTGGGGCTTCTTCTATTATAGGTGCTATTAATTTTATCTCTACCATTTTTAATATACGATCTGTTAGAATAACCATAGAGAAGGTTCCTTTATTTGTATGATCTGTTTTAATTACTGCTGTTTTATTATTATTGTCTTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTATTTTATTTCAGCATTTA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 651 bp | ||
| Sequence Upload Date: | 2020-01-28 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Gergin Blagoev,John Reaume |
| Collectors: | C. Earley |
| Specimen Identification: | Gergin A. Blagoev |
| Process ID: | ARONZ443-19 | Sample ID: | CHARS00314-A04 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2019-11-27 | Museum ID: | CGE0196 | |||
| Collection Code: | BIOUG | Field ID: | L#19ONT6-19 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DS-CANREF22 | CBG Authoritative Canadian Reference Library 2022 DS-COOLSPID | Spider photos by John Reaume |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 150729d7c64f36732f05d5061e39373e | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Arachnida | Genus: | Eratigena |
| Order: | Araneae | Species: | Eratigena agrestis |
| Family: | Agelenidae | Scientific Name Authorship: | (Walckenaer, 1802) |
| BIN ID: | BOLD:AEC1032 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | S |
|---|---|---|---|
| Tissue Descriptor: | inv leg | Sex: | F |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2018-10-10 |
|---|---|---|---|
| Province/State: | Ontario | Collection Date End: | |
| Region/County: | Wellington | Coord. Source: | Google Earth |
| Sector: | 245 Christie St., Rockwood | Coord. Accuracy: | |
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 43.628 | Depth: | |
| Longitude: | -80.146 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | C. Earley | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | Eastern_Great_Lakes_lowland_forests |
http://portal.boldsystems.org/record/ARONZ443-19 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AARONZ443-19&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AARONZ443-19&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIM8veLMjEx1jW0tM7JzM0sSU0BAMfRC2A=?length=1
© 2024 BOLDSYSTEMS