| Sequence ID: | ASCRT333-10.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) MLepF1 (GCTTTCCCACGAATAAATAATA) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TAAGATTTTGACTTTTACCACCTTCTTTAACTCTTTTATTAATAAGTAGAATAGTACAAAATGGAGCTGGGACAGGATGAACTGTTTACCCCCCCTTATCTTCTAATATTGGCCACAGAGGAGCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCGGGTATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACAGTAATTAATATACGGTCAGTAGGAATTACATTTGATCGAATACCTTTATTTGTTTGATCAGTTGTAATTACAGCTTTATTACTTCTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAACACCTCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 407 bp | ||
| Sequence Upload Date: | 2012-02-11 | ||
| Specimen Depository: | Instituto Nacional de Biodiversidad, Costa Rica |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | None |
| Collectors: | Sullivan, J. |
| Specimen Identification: | Daniel H. Janzen |
| Process ID: | ASCRT333-10 | Sample ID: | INB0003068655 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2010-03-10 | Museum ID: | ||||
| Collection Code: | Field ID: | INB0003068655 | ||||
| Deposited In: | Instituto Nacional de Biodiversidad, Costa Rica | |||||
| Associated Datasets: |
DS-ASSPATHI | Seven new species of Spathidexia Townsend from Area de Conservación Guanacaste, northwestern Costa Rica, with a key to their identification. DS-ASTACH | Tachinidae of ACG DS-INBIO | INBIO Records |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 4994fb8f8b8da67b9413b5892046ebb2 | |||||
| Kingdom: | Animalia | Subfamily: | Dexiinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Voriini |
| Class: | Insecta | Genus: | Arrhinactia |
| Order: | Diptera | Species: | Arrhinactia Wood01 |
| Family: | Tachinidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAJ2991 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | Gressett Malaise Trap | ||
| Country/Ocean: | Costa Rica (CR) | Collection Date Start: | 2003-01-06 |
|---|---|---|---|
| Province/State: | Guanacaste Province | Collection Date End: | |
| Region/County: | Area de Conservacion Guanacaste | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | A.C.G, Liberia, Pque Nal Sta Rosa, Estacion Santa Rosa | Elevation: | 300 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 10.836 | Depth: | |
| Longitude: | -85.615 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Sullivan, J. | ||
| Collection Note: | |||
| Realm: | Neotropic |
|---|---|
| Biome: | |
| Ecoregion: | Central_American_dry_forests |
http://portal.boldsystems.org/record/ASCRT333-10 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AASCRT333-10&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AASCRT333-10&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIMdg4KMTY21jU0sM7JzM0sSU0BAMaRC0g=?length=1
© 2024 BOLDSYSTEMS