| Sequence ID: | ASMII9771-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| ATTATATTTTATTTTTGGATTATGATCAGGAATACTAGGATTTTCAATAAGTTTAATTATTCGTCTAGAATTATCAACACCAACATCATTATTAGGAAATGATCAAATTTATAATACTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTAACATTAATAATTCTAAGAAGATTAATTAATCTTGGAGTAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTATTAGTCATAGAGGAATATCAGTTGATATAGGAATTTTTTCTTTACATTTAGCAGGAATATCATCAATTATAGGAGCAATTAACTTTATTACTACAATTATTAATATACGAACAAGAACATATCATATAGATAAAATACCATTATTTGTATGATCAGTTCTAATTACAGCTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCAATCACTATACTATTAACTGATCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTG | |||
| Locus: | COI-5P | ||
| Nucleotides: | 657 bp | ||
| Sequence Upload Date: | 2022-07-25 | ||
| Specimen Depository: | Western Australian Museum |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | CBG Robotic Imager |
| Collectors: | East Kimberley Kununurra students |
| Specimen Identification: | BOLD Identification System [2022] |
| Process ID: | ASMII9771-22 | Sample ID: | BIOUG85143-G09 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-06-17 | Museum ID: | BIOUG85143-G09 | |||
| Collection Code: | WAM | Field ID: | 52WA06 | |||
| Deposited In: | Western Australian Museum | |||||
| Associated Datasets: | DS-AUSCNCMI | Australian Microgastrinae in the CNC collection | |||||
| Specimen Linkout: | ||||||
| Checksum: | f1b8207e4d6cacad1d30f26b476105be | |||||
| Kingdom: | Animalia | Subfamily: | Microgastrinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | |
| Order: | Hymenoptera | Species: | |
| Family: | Braconidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAM7397 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv whole voucher | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | WA02|Insect Investigators week 2 Malaise trap 15-22 March 2022 | ||
| Country/Ocean: | Australia (AU) | Collection Date Start: | 2022-03-15 |
|---|---|---|---|
| Province/State: | Western Australia | Collection Date End: | 2022-03-22 |
| Region/County: | Coord. Source: | iPhone Googe maps | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Kununurra | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | -15.769 | Depth: | |
| Longitude: | 128.737 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | East Kimberley Kununurra students | ||
| Collection Note: | |||
| Realm: | Australasia |
|---|---|
| Biome: | Tropical_&_Subtropical-Grasslands-Savannas-&-Shrublands_simplify-0.001_buffered-0.018 |
| Ecoregion: | Kimberly_tropical_savanna |
http://portal.boldsystems.org/record/ASMII9771-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AASMII9771-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AASMII9771-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIM9vX0tDQ3N9Q1MrLOyczNLElNAQDQwQuA?length=1
© 2024 BOLDSYSTEMS