Sequence ID: | ASMII9771-22.COI-5P | GenBank Accession: | |
---|---|---|---|
Primers Forward: | Primers Reverse: | ||
Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
ATTATATTTTATTTTTGGATTATGATCAGGAATACTAGGATTTTCAATAAGTTTAATTATTCGTCTAGAATTATCAACACCAACATCATTATTAGGAAATGATCAAATTTATAATACTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTAATTCCATCTTTAACATTAATAATTCTAAGAAGATTAATTAATCTTGGAGTAGGAACTGGATGAACAGTTTATCCTCCTTTATCATTAATTATTAGTCATAGAGGAATATCAGTTGATATAGGAATTTTTTCTTTACATTTAGCAGGAATATCATCAATTATAGGAGCAATTAACTTTATTACTACAATTATTAATATACGAACAAGAACATATCATATAGATAAAATACCATTATTTGTATGATCAGTTCTAATTACAGCTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCAATCACTATACTATTAACTGATCGAAATTTAAACACAAGATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTTTG | |||
Locus: | COI-5P | ||
Nucleotides: | 657 bp | ||
Sequence Upload Date: | 2022-07-25 |
Specimen Depository: | Western Australian Museum |
---|---|
Sequencing Center: | Canadian Centre for DNA Barcoding |
Photography: | CBG Robotic Imager |
Collectors: | East Kimberley Kununurra students |
Specimen Identification: | BOLD Identification System [2022] |
Process ID: | ASMII9771-22 | Sample ID: | BIOUG85143-G09 | |||
---|---|---|---|---|---|---|
Record Created: | 2022-06-17 | Museum ID: | BIOUG85143-G09 | |||
Collection Code: | WAM | Field ID: | 52WA06 | |||
Deposited In: | Western Australian Museum | |||||
Associated Datasets: | DS-AUSCNCMI | Australian Microgastrinae in the CNC collection | |||||
Specimen Linkout: | ||||||
Checksum: | 565e296d3791c9c76030fc9b140a7382 |
Kingdom: | Animalia | Subfamily: | Microgastrinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | |
Class: | Insecta | Genus: | |
Order: | Hymenoptera | Species: | |
Family: | Braconidae | Scientific Name Authorship: | |
BIN ID: | BOLD:AAM7397 | Subspecies: | |
Identification Method: | BOLD ID Engine: top hits | ||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
---|---|---|---|
Tissue Descriptor: | inv whole voucher | Sex: | |
Brief Note: | Life Stage: | ||
Detailed Notes: | WA02|Insect Investigators week 2 Malaise trap 15-22 March 2022 |
Country/Ocean: | Australia (AU) | Collection Date Start: | 2022-03-15 |
---|---|---|---|
Province/State: | Western Australia | Collection Date End: | 2022-03-22 |
Region/County: | Coord. Source: | iPhone Googe maps | |
Sector: | Coord. Accuracy: | ||
Exact Site: | Kununurra | Elevation: | |
Habitat: | Elevation Accuracy: | ||
Latitude: | -15.769 | Depth: | |
Longitude: | 128.737 | Depth Accuracy: | |
Sampling Protocol: | Malaise Trap | ||
Collectors: | East Kimberley Kununurra students | ||
Collection Note: |
Realm: | Australasia |
---|---|
Biome: | Tropical_&_Subtropical-Grasslands-Savannas-&-Shrublands_simplify-0.001_buffered-0.018 |
Ecoregion: | Kimberly_tropical_savanna |
http://portal.boldsystems.org/record/ASMII9771-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AASMII9771-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AASMII9771-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIM9vX0tDQ3N9Q1MrLOyczNLElNAQDQwQuA?length=1
© 2024 BOLDSYSTEMS