Sequence ID: | AUMIC1226-24.COI-5P | GenBank Accession: | |
---|---|---|---|
Primers Forward: | Primers Reverse: | ||
Sequence Run Site: | Australian Genome Research Facility | ||
TATACTTTATTTCTTATTTGGATTTTGATCCGGAATATTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAATACCAGGCTCACTAATTAGAAATGATCAAATTTATAATAGTATTGTAACCTCACATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGATTAATTCCATTAATGTTAGGAGCCCCTGATATATCTTTCCCTCGCATAAATAATATAAGATTTTGATTATTAATTCCCTCATTATTTTTATTAATTTTAAGAAGATTTATTAATACAGGAGTAGGAACA | |||
Locus: | COI-5P | ||
Nucleotides: | 325 bp | ||
Sequence Upload Date: | 2024-01-15 |
Specimen Depository: | University of Adelaide, Waite Insect and Nematode Collection |
---|---|
Sequencing Center: | Australian Genome Research Facility |
Photography: | |
Collectors: | JB Dorey |
Specimen Identification: | Erinn Faganjeffries |
Process ID: | AUMIC1226-24 | Sample ID: | Extraction1218 | |||
---|---|---|---|---|---|---|
Record Created: | 2024-01-15 | Museum ID: | ||||
Collection Code: | Field ID: | BLUE_E2 | ||||
Deposited In: | University of Adelaide, Waite Insect and Nematode Collection | |||||
Associated Datasets: | ||||||
Specimen Linkout: | ||||||
Checksum: | c00497a3e879daa9167f2dd03c8ff616 |
Voucher Status: | Reproduction: | ||
---|---|---|---|
Tissue Descriptor: | Sex: | ||
Brief Note: | Life Stage: | ||
Detailed Notes: |
Country/Ocean: | Australia (AU) | Collection Date Start: | 2019-11-23 |
---|---|---|---|
Province/State: | Queensland | Collection Date End: | |
Region/County: | Coord. Source: | ||
Sector: | Coord. Accuracy: | ||
Exact Site: | Crediton | Elevation: | 796 |
Habitat: | Elevation Accuracy: | ||
Latitude: | -21.2079 | Depth: | |
Longitude: | 148.5207 | Depth Accuracy: | |
Sampling Protocol: | Sweeping | ||
Collectors: | JB Dorey | ||
Collection Note: |
Realm: | Australasia |
---|---|
Biome: | Tropical_&_Subtropical_Moist_Broadleaf_Forest |
Ecoregion: | Queensland_tropical_rain_forests |
http://portal.boldsystems.org/record/AUMIC1226-24 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AAUMIC1226-24&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AAUMIC1226-24&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIM9fV0NjQyMtM1MrHOyczNLElNAQDP1gtx?length=1
© 2024 BOLDSYSTEMS