| Sequence ID: | AUTBS011-20.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | FISHCOILBC_ts (CACGACGTTGTAAAACGACTCAACYAATCAYAAAGATATYGGCAC) | Primers Reverse: | FISHCOIHBC_ts (GGATAACAATTTCACACAGGACTTCYGGGTGRCCRAARAATCA) |
| Sequence Run Site: | Aristotle University of Thessaloniki | ||
| AGGTCAGCCTGGAGCCCTTCTAGGTGATGATCAGATTTATAATGTAATTGTCACCGCCCATGCTTTTGTAATAATTTTCTTCATAGTAATACCAATCATAATTGGAGGTTTCGGTAACTGACTAGTACCTTTAATGATTGGCGCTCCTGACATGGCATTTCCTCGGATAAATAACATAAGCTTTTGACTTCTTCCACCATCTTTCCTACTACTACTTGCTTCTTCAATAGTCGAAGCTGGGGCTGGTACGGGCTGAACTGTGTATCCCCCCTTAGCCGGAAACCTAGCCCACGCAGGAGCTTCCGTAGATTTAACCATTTTCTCCCTACATCTAGCAGGAGTATCCTCTATTCTAGGAGCAATTAATTTTATCACTACAATTATTAATATGAAACCCCCAGCACTATCCCAATATCAAACACCATTGTTCGTCTGATCCGTCTTAATTACTGCGGTCTTACTTTTACTATCCCTACCCGTCCTAGCTGCGGGCATTACTATACTCCTGA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 509 bp | ||
| Sequence Upload Date: | 2020-10-15 | ||
| Specimen Depository: | Aristotle University of Thessaloniki |
|---|---|
| Sequencing Center: | Aristotle University of Thessaloniki |
| Photography: | |
| Collectors: | Alivizatos Charalampos, Panagiotopoulou Maria |
| Specimen Identification: |
| Process ID: | AUTBS011-20 | Sample ID: | 20_AUTH_GA_011 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2020-09-28 | Museum ID: | ||||
| Collection Code: | Field ID: | 20_AUTH_GA_011 | ||||
| Deposited In: | Aristotle University of Thessaloniki | |||||
| Associated Datasets: |
DS-IUCNPUB | IUCN Red List Public DNA barcode reference library 2024 DS-MHKASIA | Mamalia Asia (-Indonesia) |
|||||
| Specimen Linkout: | ||||||
| Checksum: | e64049d2af37a6ce0655fc5c3fee00fc | |||||
| Kingdom: | Animalia | Subfamily: | Miniopterinae |
|---|---|---|---|
| Phylum: | Chordata | Tribe: | |
| Class: | Mammalia | Genus: | Miniopterus |
| Order: | Chiroptera | Species: | Miniopterus schreibersii |
| Family: | Vespertilionidae | Scientific Name Authorship: | Kuhl, 1817 |
| BIN ID: | BOLD:AAC3658 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Bulgaria (BG) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | Coordinates from country centroid | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 42.82044 | Depth: | |
| Longitude: | 25.25174 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Alivizatos Charalampos, Panagiotopoulou Maria | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | Rodope_montane_mixed_forests |
http://portal.boldsystems.org/record/AUTBS011-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AAUTBS011-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AAUTBS011-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIMDXEKNjA01DUysM7JzM0sSU0BAMZ1C0Q=?length=1
© 2024 BOLDSYSTEMS