| Sequence ID: | BBCRU203-12.COI-5P | GenBank Accession: | MF751171 |
|---|---|---|---|
| Primers Forward: | ZplankF1_t1 (TGTAAAACGACGGCCAGTTCTASWAATCATAARGATATTGG) | Primers Reverse: | ZplankR1_t1 (CAGGAAACAGCTATGACTTCAGGRTGRCCRAARAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| CACTTTATATTTAATTGCTGGAGCTTGGTCTGGTATGGTGGGTACAGGCTTAAGAATAATTATTCGAATAGAGCTGGGACAGGCCGGCTCGTTAATTGGTGATGACCAAATTTACAATGTAGTAGTAACGGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATCTTAATTGGAGGGTTTGGAAATTGATTGGTGCCATTAATGTTAGGGGCTAGAGATATAGCGTTCCCCCGAATAAATAATATAAGGTTTTGGTTTTTAATCCCCGCACTAGTGATATTGCTATCTAGATCCTTAGTAGAAAGNGGAGCAGGAACAGGGTGNACGGTGTACCCACCCCTTTCAAGAAATATCGCGCATGCTGGGAGATCTGTTGATTTTGCTATTTTTTCTCTCCATTTGGCAGGGGTGAGATCAATTTTAGGGGCAGTAAACTTTATTAGAACTCTAGGCAACCTGCGAGCTTTTGGTATAATTTTAGACCGCATACCCTTGTTTGCGTGGGCCGTATTGATTACTGCAGTTCTTTTACTTCTGTCTTTACCTGTTCTAGCAGGAGCTATCACTATACTTCTCACAGACCGAAACCTAAACTCTAGGTTTTACGACGCAGGTGGAGGTGGGGACCCTATTTTATACCAGCATCTTTTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2012-10-11 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | CBG Photography Group |
| Collectors: | T.F.Mitterboeck, C.Vandermeer, V.Junea, C.Sobel |
| Specimen Identification: | BOLD Identification System [2019] |
| Process ID: | BBCRU203-12 | Sample ID: | BIOUG02838-B05 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2012-08-14 | Museum ID: | BIOUG02838-B05 | |||
| Collection Code: | BIOUG | Field ID: | L#10PCPP-0026 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DATASET-BBPPNP1 | BIObus - Point Pelee National Park DS-17CNP05 | Canadian National Parks Data Release 05 DS-DIAPOMID | Diaptomidae from North America DS-ZIGB026 | iBOL Records Genbank Submission 026 |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 5237bed8c9a24fcf62257d88224b0962 | |||||
| Kingdom: | Animalia | Subfamily: | Diaptominae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Copepoda | Genus: | Leptodiaptomus |
| Order: | Calanoida | Species: | |
| Family: | Diaptomidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ACA6658 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | E-Vouchered:DNA/Tissue+Photo | Reproduction: | S |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | Dip Net Open Pond with thick marsh surrounding perimeter. Dip Net Mixed zooplankton | ||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2010-06-22 |
|---|---|---|---|
| Province/State: | Ontario | Collection Date End: | |
| Region/County: | Point Pelee NP | Coord. Source: | GPS, WGS84 |
| Sector: | 15km SE of Leamington | Coord. Accuracy: | |
| Exact Site: | Marsh Boardwalk Trail | Elevation: | 178 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 41.968 | Depth: | |
| Longitude: | -82.531 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | T.F.Mitterboeck, C.Vandermeer, V.Junea, C.Sobel | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Southern_Great_Lakes_forests |
http://portal.boldsystems.org/record/BBCRU203-12 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABBCRU203-12&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABBCRU203-12&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJycg4KNTIw1jU0ss7JzM0sSU0BAMVeCzc=?length=1
© 2024 BOLDSYSTEMS