| Sequence ID: | BCHYM18875-21.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TAGGAATATTTGTAGGGGATGGTGCAGGTACAGGTTGAACAGTTTATCCACCTCTTTCAAATTCTATTAATCAAGCAGGTCCAAGAGTTGATTTTTCTATTTTTTCTCTTCATTTAGCAGGGGCTTCATCAATTATAGGTGCAATAAATTTTATTGTTACAATTCTTATATTTTGTCGTTATTCATTTGATAAACTTTCATTATTTTCTTGATCGGTAATTATCACAGCTGTTTTATTATTACTTTCTTTGCCGGTTTTAGCTGGTGCTATTACAATATTATTATCTGATCGAAATTTAAATACATCATTTTTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 314 bp | ||
| Sequence Upload Date: | 2021-07-06 | ||
| Specimen Depository: | Bavarian State Collection of Zoology |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Hymenoptera Photo Group |
| Collectors: | Liebig |
| Specimen Identification: | Christian Schmid-Egger |
| Process ID: | BCHYM18875-21 | Sample ID: | ZSM-HYM-30189-D11 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2021-05-28 | Museum ID: | ZSM-HYM-30189-D11 | |||
| Collection Code: | ZSM-HYM | Field ID: | ZSM-HYM-30189-D11 | |||
| Deposited In: | Bavarian State Collection of Zoology | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 0b5dd12996f2f507537de6832feb378c | |||||
| Kingdom: | Animalia | Subfamily: | Pepsinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Priocnemis |
| Order: | Hymenoptera | Species: | Priocnemis propinqua |
| Family: | Pompilidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AEW9594 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | adult | |
| Detailed Notes: | |||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 2020-08-28 |
|---|---|---|---|
| Province/State: | Brandenburg | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | 20 km N Cottbus, TUP Lieberose, Wuste | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 51.959 | Depth: | |
| Longitude: | 14.366 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Liebig | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | Central_European_mixed_forests |
http://portal.boldsystems.org/record/BCHYM18875-21 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABCHYM18875-21&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABCHYM18875-21&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJy9oj0NbSwMDfVNTK0zsnMzSxJTQEA2sULtA==?length=1
© 2024 BOLDSYSTEMS