| Sequence ID: | BCIII192-11.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| CGAATAAATAATATTAGATTTTGATTATTACCTTGTTCTTTATTATTTTTATTAATAAGGAATTTATTTAATATAACTCCTGGAACAGGATGAACTGTTTATCCTCCTTTATCTTCATATATATTTCATTCTTCTCCATCAGTAGATATTATAATTTTTTCTTTACATTTATCAGGTATATCATCTATTTTAGGAGCAATAAATTTTATAGTAACTATTATAATAATAAAAAATTTATCAATAAATTATGATCAAATTAATTTATTTTCATGATCAGTATTTATTACAGCTATTTTATTATTATTATCATTACCAGTTTTAGCNGGNGCAATTACTATATTATTATTTGATCGAAATTTAAATACTTCATTTTTTGATCCAATAGGAGG | |||
| Locus: | COI-5P | ||
| Nucleotides: | 389 bp | ||
| Sequence Upload Date: | 2011-05-17 | ||
| Specimen Depository: | York University, Packer Collection |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | L.R.Best |
| Collectors: | L.R.Best |
| Specimen Identification: | Lincoln R. Best |
| Process ID: | BCIII192-11 | Sample ID: | LRBBC2666 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2011-01-25 | Museum ID: | LRB10-1372 | |||
| Collection Code: | PCYU | Field ID: | LRB10-1372 | |||
| Deposited In: | York University, Packer Collection | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 38082de60bfeaac85edcac23384c572c | |||||
| Kingdom: | Animalia | Subfamily: | Eucerinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Eucerini |
| Class: | Insecta | Genus: | Eucera |
| Order: | Hymenoptera | Species: | Eucera BC1 |
| Family: | Apidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAD3722 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | problematic cluster | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | F | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2010-06-25 |
|---|---|---|---|
| Province/State: | British Columbia | Collection Date End: | |
| Region/County: | Okanagan- Similkameen Reg. Dist. | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Oliver, Mt. Baldy, McKinney Camp Rd. | Elevation: | 1140 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 49.1297 | Depth: | |
| Longitude: | -119.3704 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | L.R.Best | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Palouse_prairie |
http://portal.boldsystems.org/record/BCIII192-11 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABCIII192-11&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABCIII192-11&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJy9vT0NLQ00jU0tM7JzM0sSU0BAMTkCy8=?length=1
© 2024 BOLDSYSTEMS