| Sequence ID: | BDE406-19.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCTTTAATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTACTTCCCCCTTCCTTAGTTTTATTAATTTCAAGTAGTATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCCCCACTTTCCTCTAATATTGCTCACGGTGGATCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAATATATCTTATGACCAAATACCCTTATTTGTTTGAGCTGTTGGAATTACAGCCTTATTATTATTACTTTCATTACCAGTATTAGCAGGAGCTATTACCATACTTCTTACAGATCGAAATCTTAATACATCTTTTTTTGATC | |||
| Locus: | COI-5P | ||
| Nucleotides: | 520 bp | ||
| Sequence Upload Date: | 2019-07-05 | ||
| Specimen Depository: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Roca, Josep |
| Collectors: | Enrique Garcia Barros, Miguel Lopez Munguira, Helena Romo |
| Specimen Identification: | Enrique Garcia Barros |
| Process ID: | BDE406-19 | Sample ID: | RVcoll15P407 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2019-05-10 | Museum ID: | ||||
| Collection Code: | Field ID: | RVcoll15P407 | ||||
| Deposited In: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab | |||||
| Associated Datasets: | DS-ATLAS | Atlas of mitochondrial genetic diversity for Western Palearctic butterflies | |||||
| Specimen Linkout: | ||||||
| Checksum: | 62cc61aa9261c5694022aaabe9154186 | |||||
| Kingdom: | Animalia | Subfamily: | Satyrinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Maniola |
| Order: | Lepidoptera | Species: | Maniola jurtina |
| Family: | Nymphalidae | Scientific Name Authorship: | Linnaeus, 1758 |
| BIN ID: | BOLD:AAA7785 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | Spain (ES) | Collection Date Start: | 2015-07-15 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Castile and Leon | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Masueco a Aldeadavila de la Ribera | Elevation: | 613 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 41.211887 | Depth: | |
| Longitude: | -6.579389 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Enrique Garcia Barros, Miguel Lopez Munguira, Helena Romo | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Iberian_sclerophyllous_and_semi-deciduous_forests |
http://portal.boldsystems.org/record/BDE406-19 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABDE406-19&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABDE406-19&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJycTUxMNM1tLTOyczNLElNAQCvcAqg?length=1
© 2024 BOLDSYSTEMS