Sequence ID: | BETN7800-20.COI-5P | GenBank Accession: | |
---|---|---|---|
Primers Forward: | MLepF1 (GCTTTCCCACGAATAAATAATA) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
Sequence Run Site: | Centre for Biodiversity Genomics | ||
TAAGCTTCTGACTATTACCTCCTTCTCTAACTTTATTACTAATAAGCAGATTAGTGGAAAGAGGAGCAGGGACAGGATGAACAGTGTACCCTCCCCTATCTTCAGGAATTGCCCATAGAGGAGCATCAGTTGATTTGGCAATTTTTAGCCTTCATTTAGCTGGGGTTTCTTCTATTTTAGGAGCAGTAAATTTTATTTCTACAATTATTAATATACGATCAGTAGGAATAACATTTGATCGAATACCACTATTTGTATGATCAGTGGGAATTACAGCTCTTTTACTACTTTTATCTTTACCTGTACTAGCTGGAGCTATTACTATACTATTAACTGATCGAAATTTAA | |||
Locus: | COI-5P | ||
Nucleotides: | 348 bp | ||
Sequence Upload Date: | 2020-11-16 |
Specimen Depository: | NEON Biorepository at Arizona State University |
---|---|
Sequencing Center: | Centre for Biodiversity Genomics |
Photography: | |
Collectors: | National Ecological Observatory Network, United States |
Specimen Identification: | NEON Technician |
Process ID: | BETN7800-20 | Sample ID: | NEON.BET.D02.005427 | |||
---|---|---|---|---|---|---|
Record Created: | 2020-10-07 | Museum ID: | NEON03VLU | |||
Collection Code: | NEON:CARC-DNA | Field ID: | NEON.BET.D02.005427 | |||
Deposited In: | NEON Biorepository at Arizona State University | |||||
Associated Datasets: | ||||||
Specimen Linkout: | ||||||
Checksum: | 6f0846fea4662ac56f245544864ae54d |
Kingdom: | Animalia | Subfamily: | Nebriinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | Notiophilini |
Class: | Insecta | Genus: | Notiophilus |
Order: | Coleoptera | Species: | Notiophilus aeneus |
Family: | Carabidae | Species Reference: | Herbst |
BIN ID: | BOLD:AAX5555 | Subspecies: | |
Identification Method: | Morphology | ||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Vouchered:Registered Collection | Reproduction: | S |
---|---|---|---|
Tissue Descriptor: | leg | Sex: | M |
Brief Note: | Life Stage: | adult | |
Detailed Notes: |
Country/Ocean: | United States (US) | Collection Date Start: | 2018-05-24 |
---|---|---|---|
Province/State: | Virginia | Collection Date End: | 2018-06-07 |
Region/County: | Domain 02 | Coord. Source: | GeoXH 6000 |
Sector: | Warren | Coord. Accuracy: | 20.29 |
Exact Site: | Smithsonian Conservation Biology Institute NEON | Elevation: | 315.95 |
Habitat: | deciduousForest | Elevation Accuracy: | 0.95 |
Latitude: | 38.895 | Depth: | |
Longitude: | -78.143 | Depth Accuracy: | |
Sampling Protocol: | Pitfall trap | ||
Collectors: | National Ecological Observatory Network, United States | ||
Collection Note: |
Realm: | Nearctic |
---|---|
Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
Ecoregion: | Appalachian-Blue_Ridge_forests |
http://portal.boldsystems.org/record/BETN7800-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABETN7800-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABETN7800-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJyDfEztzAw0DUysM7JzM0sSU0BAMTbCys=?length=1
© 2024 BOLDSYSTEMS