Sequence: COI-5P
| Sequence ID: | BNSB046-21.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Macrogen, Europe | ||
| AACACTTTACTTCATCTTAGGAGTTTGGTCAGGTTTAGTAGGCTCATCTATAAGAATAATTATCCGGATAGAATTAAGAGGACCAGGTAACCTTATTGGAAACGATCAAACATATAATGTAATTGTTACAGCCCATGCATTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGTTTTGGGAACTGATTAGTCCCTCTAATACTAGGAAGACCTGATATAGCATTCCCACGAATAAACAACATAAGATTTTGATTATTACCCCCCTCCCTGTCATTTTTAGTGATATCTAGCTTACTAGAAAGAGGGGTGGGTACAGGCTGAACAGTTTACCCTCCTTTAAGAAGATCTATCGCCCATAGAGGAGGAGCTGTGGACCTTGCTATTTTTTCGCTACACCTGGCAGGTGCTTCTTCTATCTTAGGGGCTATTAATTTTATTTCTACTGTAATTAATATACGATCCACGAATATATATATAAGACGAGTACCTTTATTTGTATGATCAGTTTTTATCACTGCTATTTTACTACTTTTATCTCTCCCTGTTTTAGCAGGCGCTATCACCATGCTACTAACAGATCGAAATATCAATACATCTTTTTTTGACCCTTTAGGAGGAGGAGACCCTATCCTGTACCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2021-02-25 | ||
Attribution
| Specimen Depository: | Deutsches Zentrum fuer Marine Biodiversitaetsforschung |
|---|---|
| Sequencing Center: | Macrogen, Europe |
| Photography: | Wiebke Stamerjohanns |
| Collectors: | |
| Specimen Identification: | Wiebke Stamerjohanns |
Identifiers
| Process ID: | BNSB046-21 | Sample ID: | BNSB0046 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2021-02-24 | Museum ID: | ||||
| Collection Code: | Field ID: | W39_4 | ||||
| Deposited In: | Deutsches Zentrum fuer Marine Biodiversitaetsforschung | |||||
| Associated Datasets: | DS-GEANS1 | GEANS Reference Library | |||||
| Specimen Linkout: | ||||||
| Checksum: | e6956dfcb80dfb304676e0fd8adc8b55 | |||||
Taxonomy
| Kingdom: | Animalia | Subfamily: | Corophiinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Corophiini |
| Class: | Malacostraca | Genus: | Monocorophium |
| Order: | Amphipoda | Species: | Monocorophium insidiosum |
| Family: | Corophiidae | Scientific Name Authorship: | Crawford, 1937 |
| BIN ID: | BOLD:AAE9749 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
Specimen
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | F | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
Collection
| Country/Ocean: | Germany (DE) | Collection Date Start: | 2020-10-02 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Accumersiel | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Success boat | Elevation: | |
| Habitat: | Ship fouling fauna | Elevation Accuracy: | |
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
Ecology
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
Publications
Electropherogram Trace Files
Under development - available shortly
Controller URLs
http://portal.boldsystems.org/record/BNSB046-21 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABNSB046-21&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABNSB046-21&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXLyC3YyMDHTNTK0zsnMzSxJTQEAuuIK8w==?length=1