| Sequence ID: | BSNTN283-23.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Universita di Firenze, Department of Biology | ||
| AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACTTCCTTAAGTTTATTAATTCGTGCTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTAGTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCCTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTTTAAATAATATAAGATTTTGACTTCTCCCTCCTTCTTTAAGCTTATTAATTTCAAGTTCTATCGTAGAAAACGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCTTCTAATATTGCTCATGGAGGAAGATCTGTTGATTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATAAAATTAAATGGGATAATATTCGACCAAATACCTTTATTTGTTTGAGCCGTTGGTATTACTGCTTTACTTCTTCTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGACCGAAATCTTAATACTTCCTTTTTTGATCCTGCGGGAGGAGGAGATCCTATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2023-11-08 | ||
| Specimen Depository: | Research Collection of Kai Berggren |
|---|---|
| Sequencing Center: | Universita di Firenze, Department of Biology |
| Photography: | Kai Berggren |
| Collectors: | Kai Berggren |
| Specimen Identification: | Kai Berggren |
| Process ID: | BSNTN283-23 | Sample ID: | BGE_00224_H09 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2023-06-01 | Museum ID: | ||||
| Collection Code: | Field ID: | Nor_Crete_2022466 | ||||
| Deposited In: | Research Collection of Kai Berggren | |||||
| Associated Datasets: |
DS-BGEFM | BGE Biodiversity Genomics Europe: Freshmaterial from terrestrial sampling DS-BGEUROPE | BGE Biodiversity Genomics Europe: Curated specimen barcoding output DS-LEPICRET | Lepidoptera of Crete |
|||||
| Specimen Linkout: | ||||||
| Checksum: | d6064a68e53cf4ef8ef8a1b8eb0ad109 | |||||
| Kingdom: | Animalia | Subfamily: | Phycitinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Cadra |
| Order: | Lepidoptera | Species: | Cadra figulilella |
| Family: | Pyralidae | Scientific Name Authorship: | Gregson, 1871 |
| BIN ID: | BOLD:AAZ9283 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | To Be Vouchered:Holdup/Private | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | leg | Sex: | F |
| Brief Note: | Life Stage: | adult | |
| Detailed Notes: | |||
| Country/Ocean: | Greece (GR) | Collection Date Start: | 2022-09-10 |
|---|---|---|---|
| Province/State: | Crete | Collection Date End: | |
| Region/County: | Heraklion | Coord. Source: | Google Street |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Plakias S | Elevation: | 13 |
| Habitat: | coastal scrub, large Tamarix | Elevation Accuracy: | |
| Latitude: | 35.181 | Depth: | |
| Longitude: | 24.401 | Depth Accuracy: | |
| Sampling Protocol: | LED light | ||
| Collectors: | Kai Berggren | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Crete_Mediterranean_forests |
http://portal.boldsystems.org/record/BSNTN283-23 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ABSNTN283-23&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ABSNTN283-23&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIK9gvxM7Iw1jUyts7JzM0sSU0BAMd9C1g=?length=1
© 2024 BOLDSYSTEMS