| Sequence ID: | CAB006-06.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | VERTCOIF1 (TTCTCAACCAACCAACAAAGACATTGG) | Primers Reverse: | VR1 (TAGACTTCTGGGTGGCCAAAGAATCA) |
| Sequence Run Site: | Mined from GenBank, NCBI | ||
| TATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 550 bp | ||
| Sequence Upload Date: | 2006-04-10 | ||
| Specimen Depository: | Worcester Polytechnic Institute |
|---|---|
| Sequencing Center: | Mined from GenBank, NCBI |
| Photography: | |
| Collectors: | |
| Specimen Identification: |
| Process ID: | CAB006-06 | Sample ID: | AG05055 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | |||||
| Collection Code: | Field ID: | |||||
| Deposited In: | Worcester Polytechnic Institute | |||||
| Associated Datasets: |
DS-CCDBPUB0 | Public release of pre-2010 data produced by the CCDB DS-KIKIRZ | IndoMammalia_ |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 2b14a8a3e56378713346cd0facad46af | |||||
| Kingdom: | Animalia | Subfamily: | Murinae |
|---|---|---|---|
| Phylum: | Chordata | Tribe: | |
| Class: | Mammalia | Genus: | Mus |
| Order: | Rodentia | Species: | Mus musculus |
| Family: | Muridae | Scientific Name Authorship: | Linnaeus, 1758 |
| BIN ID: | BOLD:AAA3964 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Tissue type: Tissue, Epithelial, Lens, Eye; Age: 1; Age Unit: DA; Remarks: Mouse strain CD-1 (Charles River outbred line). The culture was initiated on 1/29/80 using cells released by trypsin treatment of a lens capsule which previously had been maintained in organ culture for 5 days. The cells grow abnormally in culture and the cell morphology is epitheliallike. This line is heteroploid with all cells examined being chromosomally abnormal. | ||
| Country/Ocean: | United States (US) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/CAB006-06 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACAB006-06&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACAB006-06&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ2dDIwMNM1MLPOyczNLElNAQCuxwqT?length=1
© 2024 BOLDSYSTEMS