| Sequence ID: | CICLL016-21.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Fol-deg-for (TCNACNAAYCAYAARRAYATYGG) | Primers Reverse: | Fol-deg-rev (TANACYTCNGGRTGNCCRAARAAYCA) |
| Sequence Run Site: | Consejo Superior de Investigaciones Cientificas | ||
| TGAGCCGCTCTCGTAGGAACTGCCTTTAGAATCCTTATTCGCCTTGAGCTAGGCCAACCGGGAGCATTTATTGGGGATGACCAAACATATAACGTTATAGTGACAGCTCACGCTTTTATTATGATTTTTTTCATAGTAATACCTATTATAATTGGGGGGTTTGGTAACTGATTAGTACCCCTAATGATTGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCTTTAACGCTCCTTCTTGCAGGAGGTTTAGTAGAAAGTGGTGCCGGAACAGGATGAACAGTATACCCTCCTCTAGCCGCTGGAATTGCTCATGCCGGAGGATCTGTAGACTTATCAATTTTTAGCCTTCATCTTGCTGGGGCCTCCTCCATTTTAGGGGCCGTTAACTTTATTACCACTATTATTAATATACGAACTCCAGGAATATCTTGAGACCAAACCCCCCTATTTGTTTGGTCTGTATTTCTAACAGCCATTCTTCTTCTCCTATCACTACCAGTTTTAGCTGGCGCAATTACAATACTCTTAACTGATCGTAACTTAAATACATCATTCTTTGATCCTGCCGGTGGAGGAGACCCTATTCTCTACCAACACCTATTC | |||
| Locus: | COI-5P | ||
| Nucleotides: | 633 bp | ||
| Sequence Upload Date: | 2021-05-31 | ||
| Specimen Depository: | CSIC, Instituto de Productos Naturales y Agrobiologia |
|---|---|
| Sequencing Center: | Consejo Superior de Investigaciones Cientificas |
| Photography: | GEEI group |
| Collectors: | Island Ecology and Evolution Group - GEEI |
| Specimen Identification: | Eduardo Mateos |
| Process ID: | CICLL016-21 | Sample ID: | sci2593 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2021-05-26 | Museum ID: | sci2593 | |||
| Collection Code: | sci2593 | Field ID: | sci2593 | |||
| Deposited In: | CSIC, Instituto de Productos Naturales y Agrobiologia | |||||
| Associated Datasets: | DS-CICLL001 | CICLL001 Collembola of the Canary Islands 2024 | |||||
| Specimen Linkout: | ||||||
| Checksum: | 603429c898155d6de6e48a9073a334a7 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Collembola | Genus: | Ceratophysella |
| Order: | Poduromorpha | Species: | Ceratophysella gibbosa |
| Family: | Hypogastruridae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAA4812 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Insitution storing:Consejo Superior de Investigaciones Cientificas | ||
| Country/Ocean: | Spain (ES) | Collection Date Start: | 2020-06-09 |
|---|---|---|---|
| Province/State: | Canary Islands | Collection Date End: | |
| Region/County: | Tenerife | Coord. Source: | |
| Sector: | Anaga | Coord. Accuracy: | |
| Exact Site: | Vueltas de Taganana | Elevation: | 830 |
| Habitat: | laurel forest | Elevation Accuracy: | |
| Latitude: | 28.544 | Depth: | |
| Longitude: | -16.226 | Depth Accuracy: | |
| Sampling Protocol: | soil sampling | ||
| Collectors: | Island Ecology and Evolution Group - GEEI | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Canary_Islands_dry_woodlands_and_forests |
http://portal.boldsystems.org/record/CICLL016-21 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACICLL016-21&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACICLL016-21&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL2dPbxMTA00zUytM7JzM0sSU0BAMUeCzI=?length=1
© 2024 BOLDSYSTEMS