| Sequence ID: | CNCHB238-11.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | MHemF (GCATTYCCACGAATAAATAAYATAAG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| ATTTTGACTTTTACCTCCATCAATTACATTACTTATTATAAGATCAATAGTTGAAAGAGGAGCAGGAACAGGATGAACCGTATACCCTCCTCTTTCATCAAATATTGCACATAGAGGAGCATCTGTAGATCTAGCAATCTTTTCTTTACATTTAGCAGGTGTGTCATCAATTCTAGGAGCAATTAATTTTATTTCAACTATTATTAATATACGACCTGAAGGTATAACAGCTGAACGAATTCCATTATTTGTGTGATCAGTGGGTATTACTGCATTACTATTATTATTATCACTACCAGTTTTAGCAGGAGCTATTACAATACTATTAACAGATCGAAATTTTAATACATCATTCTTTGACCCAGTGGGGGGAGGGGATCCAATCTTATACCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 403 bp | ||
| Sequence Upload Date: | 2012-02-27 | ||
| Specimen Depository: | Canadian National Collection of Insects, Arachnids and Nematodes |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Grace Bannon |
| Collectors: | S.Vanlaerhoven |
| Specimen Identification: | Geoffrey G. E. Scudder |
| Process ID: | CNCHB238-11 | Sample ID: | CNC#HEM302138 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2011-05-18 | Museum ID: | CNC#HEM302138 | |||
| Collection Code: | CNC | Field ID: | ||||
| Deposited In: | Canadian National Collection of Insects, Arachnids and Nematodes | |||||
| Associated Datasets: |
DS-HECAMN1 | Hemiptera of Canada - Main dataset, part II DS-HECANEW | Hemiptera of Canada - New records for release |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 3822795e70efcbcc4f8f98a49d2432e2 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Oriini |
| Class: | Insecta | Genus: | Orius |
| Order: | Hemiptera | Species: | Orius minutus |
| Family: | Anthocoridae | Scientific Name Authorship: | Linnaeus, 1758 |
| BIN ID: | BOLD:ABA3643 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Tissue | Sex: | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 1991-08-02 |
|---|---|---|---|
| Province/State: | British Columbia | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Agassiz | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | S.Vanlaerhoven | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/CNCHB238-11 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACNCHB238-11&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACNCHB238-11&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL2c_ZwMjK20DU0tM7JzM0sSU0BAMTmCy4=?length=1
© 2024 BOLDSYSTEMS