Sequence ID: | CNGBK262-14.COI-5P | GenBank Accession: | KR277742 |
---|---|---|---|
Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
Sequence Run Site: | Centre for Biodiversity Genomics | ||
TATTTTTGGGGCTTGATCAGGAATAGTTGGTACTTCCCTCAGTATCTTAATTCGAGCTGAACTAGGTCACCCAGGAGCTTTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTTTAATTGGAGGATTTGGAAATTGACTAGTGCCTCTTATACTAGGAGCCCCAGATATGGCCTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCGCCCTCATTAACCCTACTATTATCAAGCTCTATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTTGCTTCCGGTATTGCACATGCTGGGGCCTCTGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTTTAGGGGCTGTAAATTTTATTACAACCGTAATTAATATACGATCTACAGGAATTACTTTAGATCGAATACCCTTATTTGTTTGATCAGTTGTAATTACTGCTATTTTACTATTACTATCTTTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCG | |||
Locus: | COI-5P | ||
Nucleotides: | 579 bp | ||
Sequence Upload Date: | 2014-03-20 |
Specimen Depository: | Centre for Biodiversity Genomics |
---|---|
Sequencing Center: | Centre for Biodiversity Genomics |
Photography: | |
Collectors: | Jeff Howard |
Specimen Identification: | Valerie Levesque-Beaudin |
Process ID: | CNGBK262-14 | Sample ID: | BIOUG10823-E10 | |||
---|---|---|---|---|---|---|
Record Created: | 2014-02-11 | Museum ID: | BIOUG10823-E10 | |||
Collection Code: | BIOUG | Field ID: | GMP#01530 | |||
Deposited In: | Centre for Biodiversity Genomics | |||||
Associated Datasets: |
DS-20GMP03 | GMP 2020 Release Batch 3 DS-BBGBNP1 | BIObus - Georgian Bay Islands National Park DS-BICNP24 | BIObus Inventory of Canada's National Parks 2013 - Insect Orders Part 2 - Diptera Part 1 - Chironomidae DS-FOND014 | BIOUG Diptera - Chironomidae |
|||||
Specimen Linkout: | ||||||
Checksum: | 362715613c2f438cc5f937ab42d3d7ae |
Kingdom: | Animalia | Subfamily: | Tanypodinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | Pentaneurini |
Class: | Insecta | Genus: | Ablabesmyia |
Order: | Diptera | Species: | Ablabesmyia americana |
Family: | Chironomidae | Scientific Name Authorship: | |
BIN ID: | BOLD:AAC8567 | Subspecies: | |
Identification Method: | BIN based | ||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
---|---|---|---|
Tissue Descriptor: | to be sampled from voucher | Sex: | |
Brief Note: | Life Stage: | A | |
Detailed Notes: | 2 malaise traps combined (+GMP#01531) |
Country/Ocean: | Canada (CA) | Collection Date Start: | 2013-05-28 |
---|---|---|---|
Province/State: | Ontario | Collection Date End: | 2013-06-04 |
Region/County: | Georgian Bay Islands National Park | Coord. Source: | GPS |
Sector: | Beausoleil Island | Coord. Accuracy: | |
Exact Site: | Cedar Spring Campground | Elevation: | 177 |
Habitat: | 1. Forest & Woodland | Elevation Accuracy: | |
Latitude: | 44.8515 | Depth: | |
Longitude: | -79.8744 | Depth Accuracy: | |
Sampling Protocol: | Malaise Trap | ||
Collectors: | Jeff Howard | ||
Collection Note: |
Realm: | |
---|---|
Biome: | |
Ecoregion: |
http://portal.boldsystems.org/record/CNGBK262-14 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACNGBK262-14&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACNGBK262-14&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL2c3fyNjIz0jU0sc7JzM0sSU0BAMVLCzU=?length=1
© 2024 BOLDSYSTEMS