| Sequence ID: | CNLMA006-14.COI-5P | GenBank Accession: | KR346492 |
|---|---|---|---|
| Primers Forward: | LepF2_t1 (TGTAAAACGACGGCCAGTAATCATAARGATATYGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| ACTTTATATTTGGAATATGATCAGGTATATTAGGATCATCATTAAGATGAATTATTCGAATCGAATTAGGACAACCTGGTTCA------TTTATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCACGCCTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCATTCCCACGAATAAATAACATAAGATTTTGACTATTACCTCCCTCAATTACTTTACTAATTATAAGAAGAATAATTGAACTAGGTGCAGGAACAGGATGAACAGTATACCCACCACTATCAAATAATATATTTCATAGAGGTGCATCAGTAGATATAGCAATCTTTTCATTACATCTAGCAGGTGTATCATCTATTCTAGGAGCAATTAAC------------------------TTTATTTCCACAATTATAAATATACGACCCACAGGAATACTACCAGAACAAATCCCCCTATTTGCATGATCAGTAGGAATTACAGCTTTACTATTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 561 bp | ||
| Sequence Upload Date: | 2014-04-30 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | Medo Toure |
| Specimen Identification: | BOLD Identification System [] |
| Process ID: | CNLMA006-14 | Sample ID: | BIOUG11225-F09 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2014-03-05 | Museum ID: | BIOUG11225-F09 | |||
| Collection Code: | BIOUG | Field ID: | GMP#01012 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DS-20GMP06 | GMP 2020 Release Batch 6 DS-BBLMNP1 | BIObus - La Mauricie National Park DS-BICNP32 | BIObus Inventory of Canada's National Parks 2013 - Insect Orders Part 3 - Hemiptera DS-FOND058 | BIOUG Hemiptera - Other |
|||||
| Specimen Linkout: | ||||||
| Checksum: | fd74c5703457087e1730effcefa4bf7f | |||||
| Kingdom: | Animalia | Subfamily: | Rhyparochrominae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Drymini |
| Class: | Insecta | Genus: | Eremocoris |
| Order: | Hemiptera | Species: | Eremocoris borealis |
| Family: | Rhyparochromidae | Scientific Name Authorship: | Dallas, 1852 |
| BIN ID: | BOLD:AAG8968 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | to be sampled from voucher | Sex: | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | 2 malaise traps combined (+GMP#01013) | ||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2013-04-30 |
|---|---|---|---|
| Province/State: | Quebec | Collection Date End: | 2013-05-08 |
| Region/County: | La Mauricie National Park | Coord. Source: | GPS |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Saint-Mathieu west park entrance near Visitor Centre | Elevation: | 219 |
| Habitat: | 1. Forest & Woodland | Elevation Accuracy: | |
| Latitude: | 46.6507 | Depth: | |
| Longitude: | -72.9698 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | Medo Toure | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Eastern_Canadian_Forest-Boreal_transition |
http://portal.boldsystems.org/record/CNLMA006-14 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACNLMA006-14&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACNLMA006-14&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL28_F1NDAw0zU0sc7JzM0sSU0BAMWACzc=?length=1
© 2024 BOLDSYSTEMS