Sequence ID: | CNPPA206-12.COI-5P | GenBank Accession: | KJ086379 |
---|---|---|---|
Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
Sequence Run Site: | Centre for Biodiversity Genomics | ||
AACTTTATATTTTATTTTTGGAGCATGATCAGGAATGGTGGGAACCTCATTAAGTATTTTAATTCGAGCTGAATTGGGGCACCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGGTTCGGAAATTGACTAGTTCCTTTAATATTAGGTGCCCCAGATATAGCCTTCCCTCGAATAAATAATATGAGTTTTTGACTTCTACCCCCCGCATTAACTTTATTGTTGGTAAGAAGTATAGTAGAAAATGGAGCTGGGACAGGATGAACTGTTTACCCTCCCTTATCTTCTAATATTGCCCATGGTGGAGCTTCTGTTGATTTAGCAATTTTTTCTTTGCATTTAGCAGGAATTTCATCAATTTTAGGAGCCGTAAACTTTATTACAACTGTAATTAATATACGATCTACAGGAATTACCTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCATTACTCCTTTTACTGTCTTTACCAGTATTAGCTGGTGCTATCACTATATTATTAACAGATCGAAATCTAAATACATCATTTTTTGATCCTGCAGGAGGAG | |||
Locus: | COI-5P | ||
Nucleotides: | 629 bp | ||
Sequence Upload Date: | 2013-11-25 |
Specimen Depository: | Centre for Biodiversity Genomics |
---|---|
Sequencing Center: | Centre for Biodiversity Genomics |
Photography: | CBG Photography Group |
Collectors: | Heidi Brown |
Specimen Identification: |
Process ID: | CNPPA206-12 | Sample ID: | BIOUG02954-H02 | |||
---|---|---|---|---|---|---|
Record Created: | 2012-09-06 | Museum ID: | BIOUG02954-H02 | |||
Collection Code: | BIOUG | Field ID: | GMP#00167 | |||
Deposited In: | Centre for Biodiversity Genomics | |||||
Associated Datasets: |
DATASET-BBPPNP1 | BIObus - Point Pelee National Park DS-20GMP08 | GMP 2020 Release Batch 8 DS-BICNP06 | BIObus Inventory of Canada's National Parks 2008-2012 - Insect Orders Part 2 - Diptera Part 1 DS-CANPESTS | A comprehensive dataset for arthropod pests of Canada (DS-CANPEST) DS-CANPESTS | A comprehensive dataset for arthropod pests of Canada (DS-CANPEST) DS-CANPESTS | A comprehensive dataset for arthropod pests of Canada (DS-CANPEST) DS-EMACH5 | Dataset for Impact Assessment Overview and Phylogenetic Tree Building DS-EMACH6 | Dataset for Barcode Gap DS-FOND019 | BIOUG Diptera - Anthomyiidae DS-PPNP12 | Point Pelee National Park Malaise Trap Program 2012 |
|||||
Specimen Linkout: | ||||||
Checksum: | d7fef2a9bf8b1b39defc121e8c1362ae |
Kingdom: | Animalia | Subfamily: | |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | |
Class: | Insecta | Genus: | Delia |
Order: | Diptera | Species: | Delia platura |
Family: | Anthomyiidae | Scientific Name Authorship: | Meigen, 1826 |
BIN ID: | BOLD:AAA3453 | Subspecies: | |
Identification Method: | |||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Vouchered:Registered Collection | Reproduction: | S |
---|---|---|---|
Tissue Descriptor: | to be sampled from voucher | Sex: | |
Brief Note: | Life Stage: | A | |
Detailed Notes: | Collected from May 2 to 9 2012 |
Country/Ocean: | Canada (CA) | Collection Date Start: | 2012-05-02 |
---|---|---|---|
Province/State: | Ontario | Collection Date End: | 2012-05-09 |
Region/County: | Point Pelee National Park | Coord. Source: | GPS |
Sector: | Cactus Field | Coord. Accuracy: | |
Exact Site: | Cedar / Savannah | Elevation: | 168 |
Habitat: | Elevation Accuracy: | ||
Latitude: | 41.9389 | Depth: | |
Longitude: | -82.5163 | Depth Accuracy: | |
Sampling Protocol: | Malaise Trap | ||
Collectors: | Heidi Brown | ||
Collection Note: |
Realm: | Nearctic |
---|---|
Biome: | |
Ecoregion: | Southern_Great_Lakes_forests |
http://portal.boldsystems.org/record/CNPPA206-12 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACNPPA206-12&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACNPPA206-12&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL2CwhwNDIw0zU0ss7JzM0sSU0BAMX-Cz4=?length=1
© 2024 BOLDSYSTEMS