| Sequence ID: | CROTR089-19.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Croatian Natural History Museum | ||
| AACTTTATATTTTTTATTTGGAATTTGATCTAGACTTTTAGGAACTTCTCTTAGAATAATTATTCGAATTGAACTTAGAACCCCCGGTTCTTTCATAGGAAATGATCAAATTTATAACTCAATTGTTACAATTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTTGTTCCCTTAATACTAGGAGCCCCAGATATGGCTTTCCCTCGAATAAATAATTTAAGATTTTGATTTCTTCCGCCTTCTCTATTTTTCCTTATCTCAAGAATATTCATGGATAATAGAGCAGGAACAGGTTGAACCGTCTACCCACCTCTTTCTAATAGTATATTCCACTCAGGAAAAGCTGTTGATATTAGAATTTTCTCTCTTCATTTAGCAGGAATTTCCTCTATTTTAGGGGCAATTAACTTTATTACTACTATTATAAATATAAAACTTAATGCCATTTCATTAGATATAATTCCTTTATTTGTTTGATCCGTTAATATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGGGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCAGCTGGAGGAGGAGACCCAATTCTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2019-07-15 | ||
| Specimen Depository: | Croatian Natural History Museum |
|---|---|
| Sequencing Center: | Croatian Natural History Museum |
| Photography: | |
| Collectors: | |
| Specimen Identification: | Mladen Kucinic |
| Process ID: | CROTR089-19 | Sample ID: | TTUNI_4 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2019-07-10 | Museum ID: | ||||
| Collection Code: | Field ID: | AC_145 | ||||
| Deposited In: | Croatian Natural History Museum | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 87bd7aeac0bb134d19b755554d29a587 | |||||
| Kingdom: | Animalia | Subfamily: | Tinodinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Tinodes |
| Order: | Trichoptera | Species: | Tinodes unicolor |
| Family: | Psychomyiidae | Scientific Name Authorship: | Pictet, 1934 |
| BIN ID: | BOLD:AAN9522 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | adult | |
| Detailed Notes: | |||
| Country/Ocean: | Croatia (HR) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | spring Rabac | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 45.0849 | Depth: | |
| Longitude: | 14.13915 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Illyrian_deciduous_forests |
http://portal.boldsystems.org/record/CROTR089-19 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACROTR089-19&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACROTR089-19&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIO8g8JMrCw1DW0tM7JzM0sSU0BAMgjC2Y=?length=1
© 2024 BOLDSYSTEMS