| Sequence ID: | CROTR399-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Croatian Natural History Museum | ||
| AACTATCTATTTTATTTTTGGGATTTGAGCTGGGATAATCGGAACTTCTCTTAGAATAATTATTCGAACTGAATTAGGAACAACTGAATCACTTATTAAAAATGATCAAATCTACAATGTCTTAGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCCATTATAATCGGAGGATTCGGTAATTGACTAGTTCCCCTAATAATCGGAGCACCTGATATAGCCTTCCCCCGTATAAATAATATAAGATTTTGGCTCCTCCCCCCCTCTCTAAATTTACTTTTAATCAGAGCTTTAGTAGAAAGAGGAACAGGAACTGGTTGAACTGTTTACCCCCCTCTTTCCAGAAATTTAGCTCATGCAGGAAGATCCGTGGATATCTCAATTTTTTCTCTCCATTTAGCCGGAATCTCTTCAATCTTAGGAGCAATTAATTTTATTTCTACCACATTAAACATACGAAATAATCTAATAACTTTAGATCGAATTCCCCTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 505 bp | ||
| Sequence Upload Date: | 2022-06-13 | ||
| Specimen Depository: | Croatian Natural History Museum |
|---|---|
| Sequencing Center: | Croatian Natural History Museum |
| Photography: | |
| Collectors: | D. Kermek, N. Pischiutta |
| Specimen Identification: |
| Process ID: | CROTR399-22 | Sample ID: | DNME71b | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-06-13 | Museum ID: | ||||
| Collection Code: | Plecoptera Collection | Field ID: | T71 | |||
| Deposited In: | Croatian Natural History Museum | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | af75ed0d31fbf6862c0fda1727f9c04d | |||||
| Kingdom: | Animalia | Subfamily: | Limnephilinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Chaetopteryx |
| Order: | Trichoptera | Species: | Chaetopteryx major |
| Family: | Limnephilidae | Scientific Name Authorship: | McLachlan, 1876 |
| BIN ID: | BOLD:AAN3995 | Subspecies: | |
| Identification Method: | Other sequence based approach | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | S |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | Croatia (HR) | Collection Date Start: | 2021-12-01 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Croatia proper | Coord. Source: | |
| Sector: | Medvednica | Coord. Accuracy: | |
| Exact Site: | creek Kraljevec | Elevation: | 378 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 45.866 | Depth: | |
| Longitude: | 15.948 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | D. Kermek, N. Pischiutta | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | Pannonian_mixed_forests |
http://portal.boldsystems.org/record/CROTR399-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACROTR399-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACROTR399-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIO8g8JMra01DUyss7JzM0sSU0BAMglC2Q=?length=1
© 2024 BOLDSYSTEMS