| Sequence ID: | CRSIA32094-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTATATTTTATTTTCGGTATTTGAGCAGGATTAGTAGGTACCTCTCTTAGATTATTAATTCGTGCTGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGTGCCCCCGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTCTTATTCTCCTAATTTCAAGAAGAATTGTAGAAAGAGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCACGGAGGAAGCTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCCTCAATTCTAGGAGCTATTAATTTCATTACTACAATTATTAATATACGACTTAATAATTTATCATTTGATCAAATACCACTATTTGTATGATCCGTAGGAATTACAGCTCTTTTACTTCTTTTATCTTTACCTGTATTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACCTCCTTTTTTGATCCAGCTGGTGGAGGAGACCCAATTTTATACCAACATTTA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 651 bp | ||
| Sequence Upload Date: | 2022-06-01 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | CBG Robotic Imager |
| Collectors: | D.Janzen, W.Hallwachs, A.Azofeifa A |
| Specimen Identification: | Daniel H. Janzen |
| Process ID: | CRSIA32094-22 | Sample ID: | BIOUG80428-C06 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-04-07 | Museum ID: | BIOUG80428-C06 | |||
| Collection Code: | BIOUG | Field ID: | GMP#32122 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 2076e13204ee454db92ddf88c7def427 | |||||
| Kingdom: | Animalia | Subfamily: | Stenomatinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Rectiostoma |
| Order: | Lepidoptera | Species: | Rectiostoma annemayae |
| Family: | Depressariidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAA0097 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | Rectiostoma annemayae | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv whole voucher | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Sirena-1A | ||
| Country/Ocean: | Costa Rica (CR) | Collection Date Start: | 2019-11-02 |
|---|---|---|---|
| Province/State: | Puntarenas Province | Collection Date End: | 2019-11-10 |
| Region/County: | Area de Conservacion Osa | Coord. Source: | |
| Sector: | Parque Nacional Corcovado, Sector Sirena | Coord. Accuracy: | |
| Exact Site: | Sirena-1 | Elevation: | 30 |
| Habitat: | 1. Forest & Woodland | 1.6. Subtropical/Tropical Moist Lowland Forest | Elevation Accuracy: | |
| Latitude: | 8.478 | Depth: | |
| Longitude: | -83.593 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | D.Janzen, W.Hallwachs, A.Azofeifa A | ||
| Collection Note: | |||
| Realm: | Neotropic |
|---|---|
| Biome: | Tropical_&_Subtropical_Moist_Broadleaf_Forest |
| Ecoregion: | Isthmian-Pacific_moist_forests |
http://portal.boldsystems.org/record/CRSIA32094-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACRSIA32094-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACRSIA32094-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIOCvZ0NDYysDTRNTKyzsnMzSxJTQEA2lgLqQ==?length=1
© 2024 BOLDSYSTEMS