| Sequence ID: | CRU029-20.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lab | ||
| CAACCGGGAAGCCTTATTGGAGATGACCAAATTTATAATGTAGTAGTTACAGCCCACGCTTTTGTTATAATTTTCTTTATAGTTATGCCTATTATAATTGGGGGATTTGGAAATTGGCTAGTACCTTTAATGTTAGGTGCTCCTGATATGGCTTTTCCACGAATAAACAATATGAGTTTCTGGCTCCTACCTCCTTCACTAACACTACTTCTTTCTAGAGGTATAGTTGAAAGAGGAGTAGGAACAGGATGGACTGTTTACCCTCCTTTATCAGCCAGTATTGCTCATGCTGGGGCTTCGGTAGATTTAGGAATTTTCTCCCTACACTTGGCAGGTGTTTCTTCAATTTTAGGAGCTGTAAATTTTATGACAACTGTTATTAACATACGATCTACGGGAATAACTATAGACCGAATACCGCTTTTCGTTTGGGCAGTATTTATTACAGCATTACTTCTCTTATTATCTCTACCGGTACTAGCAGGAGCCATTACAATACTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 501 bp | ||
| Sequence Upload Date: | 2020-06-10 | ||
| Specimen Depository: | Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lab |
|---|---|
| Sequencing Center: | Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lab |
| Photography: | |
| Collectors: | Dr. Kazi Ahsan Habib, Amit Kumer Neogi |
| Specimen Identification: |
| Process ID: | CRU029-20 | Sample ID: | P1611Sb-10 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2020-06-10 | Museum ID: | P1611Sb-10 | |||
| Collection Code: | P1611Sb-10 | Field ID: | P1611Sb-10 | |||
| Deposited In: | Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lab | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 259ae6a8632621af6f44c1d66964d586 | |||||
| Kingdom: | Animalia | Subfamily: | |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Malacostraca | Genus: | Penaeus |
| Order: | Decapoda | Species: | Penaeus indicus |
| Family: | Penaeidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ACB5891 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Bangladesh (BD) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Southwest | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Sundarbans | Elevation: | |
| Habitat: | Mangrove | Elevation Accuracy: | |
| Latitude: | 21.89 | Depth: | |
| Longitude: | 89.498 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Dr. Kazi Ahsan Habib, Amit Kumer Neogi | ||
| Collection Note: | |||
| Realm: | Indomalayan |
|---|---|
| Biome: | Mangroves_simplify-0.01_buffered-0.018 |
| Ecoregion: | Sundarbans_mangroves |
http://portal.boldsystems.org/record/CRU029-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ACRU029-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ACRU029-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIOCjUwstQ1MrDOyczNLElNAQCxEAq4?length=1
© 2024 BOLDSYSTEMS