| Sequence ID: | DEPAL062-20.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| AATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAACATACGATTAAATAGTATATCTTTCGATCAAATACCATTATTCGTTTGAGCTGTAGGAATTACAGCTTTATTACTACTTTTATCCTTA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 136 bp | ||
| Sequence Upload Date: | 2020-04-29 | ||
| Specimen Depository: | Natural History Museum, London |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | |
| Collectors: | JFA Kalis |
| Specimen Identification: | Mark J Sterling |
| Process ID: | DEPAL062-20 | Sample ID: | NHMUK010923220 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2020-01-29 | Museum ID: | NHMUK 010923220 | |||
| Collection Code: | NHMUK | Field ID: | NHMUK 010923220 | |||
| Deposited In: | Natural History Museum, London | |||||
| Associated Datasets: | DS-TOPIRIS | DNA barcodes of Topiris and Athrypsiastis | |||||
| Specimen Linkout: | ||||||
| Checksum: | 614ecdd686b88726f88e4900a0f1a2f4 | |||||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Indonesia (ID) | Collection Date Start: | 1937-03-15 |
|---|---|---|---|
| Province/State: | Sulawesi Tengah | Collection Date End: | |
| Region/County: | Sulawesi | Coord. Source: | |
| Sector: | Palu | Coord. Accuracy: | |
| Exact Site: | Koelawi | Elevation: | 1000 |
| Habitat: | Elevation Accuracy: | 100 | |
| Latitude: | -0.87 | Depth: | |
| Longitude: | 119.99 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | JFA Kalis | ||
| Collection Note: | |||
| Realm: | Australasia |
|---|---|
| Biome: | Tropical_&_Subtropical_Moist_Broadleaf_Forest |
| Ecoregion: | Sulawesi_montane_rain_forests |
http://portal.boldsystems.org/record/DEPAL062-20 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ADEPAL062-20&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ADEPAL062-20&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJxDXD0MTAz0jUysM7JzM0sSU0BAMUeCzE=?length=1
© 2024 BOLDSYSTEMS