| Sequence ID: | EBGEP552-24.rbcL | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Naturalis Biodiversity Center | ||
| TACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCTGGGGTTCCCCCGGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTGCTGGGGAAGACAACCAATGGATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTAGAGGATCTACGAATTCCCGTTGCTTATGCAAAAACTTTCCAAGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAATTACGGTAGAGCGTGTTATGAGTGTCTACGTGGTGGACTTGATTTTAC | |||
| Locus: | rbcL | ||
| Nucleotides: | 530 bp | ||
| Sequence Upload Date: | 2026-02-26 | ||
| Specimen Depository: | Royal Botanic Garden Edinburgh |
|---|---|
| Sequencing Center: | Naturalis Biodiversity Center |
| Photography: | ckemnitz |
| Collectors: | Ian Hedge, P Woods |
| Specimen Identification: |
| Process ID: | EBGEP552-24 | Sample ID: | BGE_00276_G05 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2024-12-09 | Museum ID: | E00923443 | |||
| Collection Code: | Field ID: | Hedge and Woods Edin. No. 2406 | ||||
| Deposited In: | Royal Botanic Garden Edinburgh | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | cec27afb19db8876d5f362ad73fd16bc | |||||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | Leaf | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | United Kingdom (GB) | Collection Date Start: | 1958-07-12 |
|---|---|---|---|
| Province/State: | Scotland | Collection Date End: | |
| Region/County: | Sutherland | Coord. Source: | approximate location, taken from a map |
| Sector: | Loch Shin | Coord. Accuracy: | |
| Exact Site: | east edge of Loch Shin, about 3 miles north of Lairg | Elevation: | 91.44 |
| Habitat: | damp area at edge of loch | Elevation Accuracy: | |
| Latitude: | 58.073425 | Depth: | |
| Longitude: | -4.465074 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Ian Hedge, P Woods | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/EBGEP552-24 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AEBGEP552-24&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AEBGEP552-24&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ1cncNMDU10jUysc7JzM0sSU0BAMU7CzY=?length=1
© 2024 BOLDSYSTEMS