Sequence ID: | EULEP053-14.COI-5P | GenBank Accession: | KP870420 |
---|---|---|---|
Primers Forward: | Primers Reverse: | ||
Sequence Run Site: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab | ||
AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCCCTTAGCCTAATTATTCGAACAGAATTAGGTACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCTCTTATACTAGGAGCCCCTGATATAGCTTTCCCCCGAATGAATAATATAAGATTTTGATTATTGCCCCCCTCCCTAATATTATTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATTGCTCATGGAGGATCTTCTGTAGATCTAGCAATTTTCTCTCTTCATTTAGCAGGAATTTCTTCCATTCTAGGAGCTATTAATTTCATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTACTTTCTCTTCCAGTATTAGCAGGAGCTATTACCATACTTCTTACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT | |||
Locus: | COI-5P | ||
Nucleotides: | 658 bp | ||
Sequence Upload Date: | 2014-09-28 |
Specimen Depository: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab |
---|---|
Sequencing Center: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab |
Photography: | |
Collectors: | |
Specimen Identification: | Vlad Dinca |
Process ID: | EULEP053-14 | Sample ID: | RVcoll.08-J480 | |||
---|---|---|---|---|---|---|
Record Created: | 2014-09-24 | Museum ID: | RVcoll.08-J480 | |||
Collection Code: | Field ID: | |||||
Deposited In: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab | |||||
Associated Datasets: |
DS-ALPAPENN | Butterflies of the Alps and Apennines DS-EUGENMAP | European butterflies DS-IBEUR | Iberia-Europe DS-WEUP | WesternEurope Project |
|||||
Specimen Linkout: | ||||||
Checksum: | a4d895a4c4dd1e3cd9cb93403727e70b |
Kingdom: | Animalia | Subfamily: | Satyrinae |
---|---|---|---|
Phylum: | Arthropoda | Tribe: | Satyrini |
Class: | Insecta | Genus: | Minois |
Order: | Lepidoptera | Species: | Minois dryas |
Family: | Nymphalidae | Scientific Name Authorship: | |
BIN ID: | BOLD:AAB9884 | Subspecies: | |
Identification Method: | |||
Taxonomy Notes: | |||
* Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings |
Voucher Status: | Reproduction: | S | |
---|---|---|---|
Tissue Descriptor: | Sex: | ||
Brief Note: | Life Stage: | A | |
Detailed Notes: |
Country/Ocean: | Spain (ES) | Collection Date Start: | 2004-08-07 |
---|---|---|---|
Province/State: | Collection Date End: | ||
Region/County: | Asturias | Coord. Source: | |
Sector: | Coord. Accuracy: | ||
Exact Site: | Cruz de Priena, Covadonga, Picos de Europa | Elevation: | |
Habitat: | Elevation Accuracy: | ||
Latitude: | 43.3 | Depth: | |
Longitude: | -5.047 | Depth Accuracy: | |
Sampling Protocol: | |||
Collectors: | |||
Collection Note: |
Realm: | Palearctic |
---|---|
Biome: | |
Ecoregion: | Cantabrian_mixed_forests |
http://portal.boldsystems.org/record/EULEP053-14 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AEULEP053-14&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AEULEP053-14&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIN9XENMDA11jU0sc7JzM0sSU0BAMaiC0k=?length=1
© 2024 BOLDSYSTEMS