| Sequence ID: | EZRMN041-08.COI-5P | GenBank Accession: | HQ004647 |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGAATTTTAATTCGTCTTGAATTAGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCCTTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCACCATCTTTATTATTGTTAATTTCAAGAAGAATTGTTGAAAATGGGGCAGGCACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCGGGTATCTCTTCAATTTTAGGTGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCTTTTGATCAAATATCTTTATTTATTTGAAGTGTAGGAATTACAGCTTTATTATTACTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2009-11-10 | ||
| Specimen Depository: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Butterfly Study Group at IBE |
| Collectors: | |
| Specimen Identification: | Vlad Dinca |
| Process ID: | EZRMN041-08 | Sample ID: | RVcoll.07-D006 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | |||||
| Collection Code: | Field ID: | RVcoll.07-D006 | ||||
| Deposited In: | Institut de Biologia Evolutiva (CSIC-UPF), Butterfly Diversity and Evolution Lab | |||||
| Associated Datasets: |
DS-ALPAPENN | Butterflies of the Alps and Apennines DS-EUGENMAP | European butterflies DS-EZROM | Complete DNA barcode reference library for a country's butterfly fauna reveals high performance for temperate Europe DS-IBEUR | Iberia-Europe DS-IUCNPUB | IUCN Red List Public DNA barcode reference library 2024 DS-MARKALL | Dataset for 41583 records of European Lepidoptera |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 938ea8001fa8bc1b95cd33d81dec4269 | |||||
| Kingdom: | Animalia | Subfamily: | Lycaeninae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Lycaenini |
| Class: | Insecta | Genus: | Lycaena |
| Order: | Lepidoptera | Species: | Lycaena dispar |
| Family: | Lycaenidae | Scientific Name Authorship: | Haworth, 1803 |
| BIN ID: | BOLD:ACE4022 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Romania (RO) | Collection Date Start: | 2007-05-22 |
|---|---|---|---|
| Province/State: | Constanta | Collection Date End: | |
| Region/County: | Dobrogea | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Canaraua Fetei (Baneasa) | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 44.061 | Depth: | |
| Longitude: | 27.649 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Balkan_mixed_forests |
http://portal.boldsystems.org/record/EZRMN041-08 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AEZRMN041-08&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AEZRMN041-08&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXKNCvL1MzAx1DWwsM7JzM0sSU0BAMe5C1o=?length=1
© 2024 BOLDSYSTEMS