| Sequence ID: | FBACA241-10.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | RonIIdeg_R (GGRGGRTARAYAGTTCATCCWGTWCC, AMR1deg_R:CAWCCWGTWCCKRMNCCWKCAT) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| GATCAGGaatGaTAGGCTCAGCATTAAGTATACTTATTCGATTAGAACTTGGATCTCCTGATAAATTAATTGGCAATGATCAAATTTATAATACTATTGTTACTTCACATGCCTTTATCATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATATTATCTGCGCCAGATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCTCCTTCTTTATTTTTATTAATCGCAAGAAACTATATTGGTAGAGGAGTTGGAACNGGATGAaCTatNTACCC | |||
| Locus: | COI-5P | ||
| Nucleotides: | 316 bp | ||
| Sequence Upload Date: | 2012-07-13 | ||
| Specimen Depository: | Bavarian State Collection of Zoology |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | ZSM Hymenoptera Photography Group |
| Collectors: | C. Schmid-Egger |
| Specimen Identification: | Stefan Schmidt |
| Process ID: | FBACA241-10 | Sample ID: | BC ZSM HYM 04801 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2010-07-14 | Museum ID: | BC ZSM HYM 04801 | |||
| Collection Code: | SNSB-ZSM-HYM | Field ID: | BC ZSM HYM 04801 | |||
| Deposited In: | Bavarian State Collection of Zoology | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 6cef284f5cd40a10d7d4949b1a7ffc14 | |||||
| Kingdom: | Animalia | Subfamily: | Eumeninae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Odynerus |
| Order: | Hymenoptera | Species: | Odynerus reniformis |
| Family: | Vespidae | Scientific Name Authorship: | Gmeling, 1790 |
| BIN ID: | BOLD:AAV3568 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 1992-05-23 |
|---|---|---|---|
| Province/State: | Rhineland-Palatinate | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Landau, Waldrohrbach | Elevation: | 242 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 49.1702 | Depth: | |
| Longitude: | 7.9658 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | C. Schmid-Egger | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Western_European_broadleaf_forests |
http://portal.boldsystems.org/record/FBACA241-10 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AFBACA241-10&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AFBACA241-10&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJzcnR2NDIx1DU0sM7JzM0sSU0BAMN2CxY=?length=1
© 2024 BOLDSYSTEMS