| Sequence ID: | FBAPB640-09.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | RonMWASPdeg_t1 (TGTAAAACGACGGCCAGTGGWTCWCCWGATATAKCWTTTCC) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TTCCTCGTATAAATAATATGAGATTTTGATTATTGCCTCCATCTTTATTAGTTTTAATATTAGGTATATTTGTAGGGGATGGGGCAGGTACTGGATGAACAGTTTATCCTCCTCTTTCTAGTTCAATTTATCAAGCAGGACCTAGAGTAGATTTATCTATTTTTTCTCTTCATTTAGCTGGTATATCTTCTATCATAGGAGCAATGAATTTTATTATTACTATTATTTTAACAACTCGTTCTTTT------TTTGATAAGGTAACATTATTTTGTTGGTCTGTTTTTATTACAGCTGTTTTATTGCTTCTTTCTTTACCAGTTCTTGCCGGTGCAATTACAATACTTCTATCGGATCGTAATTTTAGAACAACTTTTTTTGTACCAATAGGTGGGGGTGATCCTATTTTATATCAACATT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 420 bp | ||
| Sequence Upload Date: | 2011-07-27 | ||
| Specimen Depository: | Bavarian State Collection of Zoology |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | ZSM Hymenoptera Photography Group |
| Collectors: | C. Schmid-Egger |
| Specimen Identification: | Christian Schmid-Egger |
| Process ID: | FBAPB640-09 | Sample ID: | BC ZSM HYM 02115 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2009-12-08 | Museum ID: | BC ZSM HYM 02115 | |||
| Collection Code: | SNSB-ZSM-HYM | Field ID: | BC ZSM HYM 02115 | |||
| Deposited In: | Bavarian State Collection of Zoology | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 150ef7eaa5f1677f970030b529875aae | |||||
| Kingdom: | Animalia | Subfamily: | Pompilinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Agenioideus |
| Order: | Hymenoptera | Species: | Agenioideus usurarius |
| Family: | Pompilidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAY9890 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | F | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Italy (IT) | Collection Date Start: | 1997-07-13 |
|---|---|---|---|
| Province/State: | Aosta Valley | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | St. Pierre | Elevation: | 750 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 45.7 | Depth: | |
| Longitude: | 7.32 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | C. Schmid-Egger | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Alps_conifer_and_mixed_forests |
http://portal.boldsystems.org/record/FBAPB640-09 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AFBAPB640-09&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AFBAPB640-09&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJzcgxwMjMx0DWwtM7JzM0sSU0BAMTICy8=?length=1
© 2024 BOLDSYSTEMS