| Sequence ID: | GBLAC204-13.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATCGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGACTTCTACCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACCGGATGAACAGTTTATCCTCCTCTTTCTTCTAACATTGCTCATAGAGGTAGTTCAGTAGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATCAATATACGATTAAATAATTTAATATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACTGCATTTCTTCTTCTTCTTTCCCTACCAGTATTAGCTGGAGCTATTACTATACTTCTAACTGATCGAAATTTAAATACTTCCTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2014-03-06 | ||
| Specimen Depository: | Bavarian State Collection of Zoology |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Jerome Moriniere |
| Collectors: | A. Hausmann |
| Specimen Identification: | Axel Hausmann |
| Process ID: | GBLAC204-13 | Sample ID: | BC ZSM Lep 78585 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2013-11-25 | Museum ID: | BC ZSM Lep 78585 | |||
| Collection Code: | SNSB-ZSM-LEP | Field ID: | BC ZSM Lep 78585 | |||
| Deposited In: | Bavarian State Collection of Zoology | |||||
| Associated Datasets: | DS-BWPST | Pest and other economically important species of arthropods in Europe | |||||
| Specimen Linkout: | ||||||
| Checksum: | f5813835f738aa1e0a328ec9f2bb7f2b | |||||
| Kingdom: | Animalia | Subfamily: | Erebinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Catocalini |
| Class: | Insecta | Genus: | Catocala |
| Order: | Lepidoptera | Species: | Catocala nupta |
| Family: | Erebidae | Scientific Name Authorship: | Linnaeus, 1767 |
| BIN ID: | BOLD:ACE8723 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | F | |
| Brief Note: | Life Stage: | a | |
| Detailed Notes: | |||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 2013-09-15 |
|---|---|---|---|
| Province/State: | Bavaria | Collection Date End: | |
| Region/County: | Oberbayern | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Oberschleissheim | Elevation: | 481 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 48.2574 | Depth: | |
| Longitude: | 11.5452 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | A. Hausmann | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Western_European_broadleaf_forests |
http://portal.boldsystems.org/record/GBLAC204-13 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGBLAC204-13&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGBLAC204-13&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXJ38nF0NjIw0TU0ts7JzM0sSU0BAMRNCyQ=?length=1
© 2024 BOLDSYSTEMS