| Sequence ID: | GMEGA203-14.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| ACTTTATATTTTATTTTTGGTCTTTGATCAGGGATAGTGGGTACATCATTAAGTATGTTAATTCGAATTGAATTAGGAAATCCAGGATCTCTAATTGGAGATGATCAAATTTATAATGTTATTGTAACTGCCCACGCTTTTATTATAATTTTCTTTATAGTTATACCGATTATAATTGGGGGATTTGGGAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAACAATATAAGATTCTGATTATTACCTCCTTCATTAACTCTTTTATTAATAAGTAGAATTGTAGAAAAAGGAGCAGGGACTGGGTGAACAGTTTACCCCCCATTAGCAGCCAATATTGCGCATAGAGGGGCATCAGTTGATTTAGCTATTTTTAGATTACATTTAGCGGGAATTTCCTCAATTTTAGGGGCAGTAAATTTTATTTCCACAATAATAAATATGCGACCTGCAGGACTATCCTTAGATCAATTATCTTTATTTACTTGAGCCGTTAAAATTACTGCTATTTTATTACTTCTTTCTTTACCAGTTTTAGCTGGGGCAATTACTATGCTATTAACTGATCGAAATATTAAC | |||
| Locus: | COI-5P | ||
| Nucleotides: | 600 bp | ||
| Sequence Upload Date: | 2014-05-12 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | O.El-Ansary |
| Specimen Identification: | BOLD Identification System [2017] |
| Process ID: | GMEGA203-14 | Sample ID: | BIOUG12234-B01 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2014-04-04 | Museum ID: | BIOUG12234-B01 | |||
| Collection Code: | BIOUG | Field ID: | GMP#01778 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DS-MAEGY | Malaise trap collection from Egypt DS-MAREG | Revealing insect diversity in the Saharo-Arabian region by Malaise trap-DNA barcoding |
|||||
| Specimen Linkout: | ||||||
| Checksum: | a6fbc394edaa0727793c194ff96e652a | |||||
| Kingdom: | Animalia | Subfamily: | Apioninae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Apionini |
| Class: | Insecta | Genus: | Malvapion |
| Order: | Coleoptera | Species: | Malvapion malvae |
| Family: | Brentidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAN9538 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv leg | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | Collected from 20-may-13 to 27-May-13 | ||
| Country/Ocean: | Egypt (EG) | Collection Date Start: | 2013-05-20 |
|---|---|---|---|
| Province/State: | Alexandria | Collection Date End: | 2013-05-27 |
| Region/County: | Coord. Source: | ||
| Sector: | Mariot | Coord. Accuracy: | |
| Exact Site: | Mostafa Kamel Village | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 30.9256 | Depth: | |
| Longitude: | 29.7755 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | O.El-Ansary | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Mediterranean_dry_woodlands_and_steppe |
http://portal.boldsystems.org/record/GMEGA203-14 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGMEGA203-14&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGMEGA203-14&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL3dXV3NDIw1jU0sc7JzM0sSU0BAMTbCyw=?length=1
© 2024 BOLDSYSTEMS