| Sequence ID: | GMEGL116-14.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG, LCO1490:GGTCAACAAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA, HCO2198:TAAACTTCAGGGTGACCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TTAAGAATAATTATTCGAATAGAATTAGGAACTGTATCTCAATTAATTGGGGAC---GATCAAATTTATAATACTCTAATTACTAGACATGCTTTTATTATAATTTTTTTTATAGTAATACCATTTATAATTGGTGGATTTGGAAATTGATTAGTTCCATTAATA---TTAGGAGCACCAGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCATCATTAAGAATATTAATTTTTAGAAGAATTACAGATACAGGAACAGGAACCGGATGAACAGTATATCCACCACTTTCATCATCATTATATACAAGTGGTTATTCAGTTGATTTATCA---ATTTTTTCACTACATATTGCAGGAATTTCCTCTATTATAGGAGCAATTAATTTTATTGTTACAATTAAAAAAATACATAATAAAGAATTAAATTTTGATCAAGTAACATTATTTCCATGATCAATTTTTATTACAGCTATTCTATTATTATTATCTCTTCCTGTATTAGCT---AGGGCCATTACTATA | |||
| Locus: | COI-5P | ||
| Nucleotides: | 540 bp | ||
| Sequence Upload Date: | 2014-09-22 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | CBG Photography Group |
| Collectors: | O.El-Ansary |
| Specimen Identification: | Toshko Ljubomirov |
| Process ID: | GMEGL116-14 | Sample ID: | BIOUG14631-D12 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2014-08-08 | Museum ID: | BIOUG14631-D12 | |||
| Collection Code: | BIOUG | Field ID: | GMP#01781 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: |
DS-20GMP27 | GMP 2020 Release Batch 27 DS-MAEGY | Malaise trap collection from Egypt DS-MAREG | Revealing insect diversity in the Saharo-Arabian region by Malaise trap-DNA barcoding |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 2c1665c87a259de63e006b7309dbe7fd | |||||
| Kingdom: | Animalia | Subfamily: | Crabroninae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Trypoxilini |
| Class: | Insecta | Genus: | Trypoxylon |
| Order: | Hymenoptera | Species: | Trypoxylon deceptorium |
| Family: | Crabronidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ACC3093 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | det.: T.Ljubomirov, April 27th, 2017 - Sofia | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | to be sampled from voucher | Sex: | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | Collected from 10-jun-13 to 17-jun-13 | ||
| Country/Ocean: | Egypt (EG) | Collection Date Start: | 2013-06-10 |
|---|---|---|---|
| Province/State: | Alexandria | Collection Date End: | 2013-06-17 |
| Region/County: | Mariot | Coord. Source: | |
| Sector: | Mostafa Kamel Village | Coord. Accuracy: | |
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 30.9256 | Depth: | |
| Longitude: | 29.7755 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | O.El-Ansary | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Mediterranean_dry_woodlands_and_steppe |
http://portal.boldsystems.org/record/GMEGL116-14 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGMEGL116-14&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGMEGL116-14&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL3dXX3MTQ00zU0sc7JzM0sSU0BAMWjCzo=?length=1
© 2024 BOLDSYSTEMS