| Sequence ID: | GMGMR1018-18.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| ATTATATTTCTTATTTGGTATATGATCAGGAATAATTGGATCATCACTTAGAATATTAATTCGACTTGAACTTAGACAAATCAATTCTATTATTAATAACAACCAATTATATAATGTAATTATTACAATTCATGCATTTATCATAATTTTTTTTATAACTATACCAATTGTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATAATAGGATGCCCTGATATATCATTCCCACGACTTAATAATATTAGATTTTGACTATTACCACCTTCATTAATAATAATAATTTCTAGATTTATTATTAATAATGGAACAGGAACAGGTTGAACTATTTACCCCCCTCTTTCTAATAACATTGCCCATAATAATATTTCAGTAGATTTAACTATTTTTTCATTACATTTAGCAGGAATCTCTTCTATTTTAGGAGCTATCAATTTTATTTGTACTATCCTAAATATAATACCTCATAATATAAAAATTAATCAAATCCCCCTATTCCCATGATCAATCTTAATTACAGCAACTTTATTAATTTTATCATTACCAGTTTTAGCTGGTGCAATTACTATATTATTGACTGATCGAAACCTAAATACATCTTTCTTTGACCCATCAGGAGGAGGAGATCCAATTTTATATCAACATCTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 653 bp | ||
| Sequence Upload Date: | 2019-04-08 | ||
| Specimen Depository: | Bavarian State Collection of Zoology |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | Axel Hausman |
| Specimen Identification: | BOLD Identification System [2019] |
| Process ID: | GMGMR1018-18 | Sample ID: | BIOUG42948-D04 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2018-08-01 | Museum ID: | BIOUG42948-D04 | |||
| Collection Code: | SNSB | Field ID: | GMP#10408 | |||
| Deposited In: | Bavarian State Collection of Zoology | |||||
| Associated Datasets: |
DS-DRKTAXA | Merging of the Projects GMTBZ, GMTPE and AMTP DS-ZSMTRAP | Barcoding of ZSM Trap 2017 |
|||||
| Specimen Linkout: | ||||||
| Checksum: | c1c27da6973ca95e2ee054cdcefbf615 | |||||
| Kingdom: | Animalia | Subfamily: | Anoeciinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Anoecia |
| Order: | Hemiptera | Species: | Anoecia corni |
| Family: | Aphididae | Scientific Name Authorship: | Fabricius, 1775 |
| BIN ID: | BOLD:AAH2871 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv whole voucher | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 2017-09-18 |
|---|---|---|---|
| Province/State: | Bavaria | Collection Date End: | 2017-09-25 |
| Region/County: | Munich | Coord. Source: | GPS |
| Sector: | Zoologische Staatssammlung Muenchen | Coord. Accuracy: | |
| Exact Site: | Elevation: | 519 | |
| Habitat: | Urban | Elevation Accuracy: | |
| Latitude: | 48.165 | Depth: | |
| Longitude: | 11.485 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | Axel Hausman | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Western_European_broadleaf_forests |
http://portal.boldsystems.org/record/GMGMR1018-18 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGMGMR1018-18&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGMGMR1018-18&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL3dfcNMjQwtNA1tLDOyczNLElNAQDQhwt-?length=1
© 2024 BOLDSYSTEMS