| Sequence ID: | GMLBA11083-23.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| CTTTATATTTAATTTTTGGAGCATGAGCAGGAATAGTAGGAACATCTCTTAGACTTTTAATTCGAACTGAATTAGGAAGACCAGGATCTTTAATTGGAGATGACCAAATTTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTGTAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATACTCGGAGCACCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTACTCCCCCCATCATTAACTTTATTAATTATAAGAAGAATAGTAGAAAGTGGTGCAGGTACTGGTTGAACAGTTTATCCTCCTCTATCTTCCAATATTGCGCATGGAGGATCTTCAGTTGATTTAGCTATTTTTAGACTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACAACAGTAATTAATATACGACCTGTAGGAATAACATTAGACCGAATACCATTATTTGTCTGAGCCGTTGTAATTACAGCAATTCTATTACTTCTATCTTTACCAGTTTTAGCTGGAGCAATTACTATACTTTTAACAGATCGAAACTTAAATACATCATTTTTTGATCCAGCCGGAGGAGGAGATCCAATTCTATATCAACATTTATT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 655 bp | ||
| Sequence Upload Date: | 2023-09-15 | ||
| Specimen Depository: | Centre for Biodiversity Genomics |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | CBG Robotic Rig |
| Collectors: | Magda Bou Dagher Kharrat |
| Specimen Identification: |
| Process ID: | GMLBA11083-23 | Sample ID: | CBG-A08787-B11 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2023-08-16 | Museum ID: | CBG-A08787-B11 | |||
| Collection Code: | BIOUG | Field ID: | GMP#16374 | |||
| Deposited In: | Centre for Biodiversity Genomics | |||||
| Associated Datasets: | DS-INSCTLEB | DNA barcode survey of insects from Lebanon 1 | |||||
| Specimen Linkout: | ||||||
| Checksum: | e12a893d9dae8f7678c29617f2f6d357 | |||||
| Kingdom: | Animalia | Subfamily: | Oedemerinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Oedemerini |
| Class: | Insecta | Genus: | Oedemera |
| Order: | Coleoptera | Species: | Oedemera flavipes |
| Family: | Oedemeridae | Scientific Name Authorship: | |
| BIN ID: | BOLD:ADZ8481 | Subspecies: | |
| Identification Method: | BOLD ID Engine | ||
| Taxonomy Notes: | image classification: ViT-P16-224 v2: Coleoptera | ||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Vouchered:Registered Collection | Reproduction: | |
|---|---|---|---|
| Tissue Descriptor: | inv leg | Sex: | |
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Lebanon (LB) | Collection Date Start: | 2019-06-24 |
|---|---|---|---|
| Province/State: | Mount Lebanon | Collection Date End: | 2019-06-30 |
| Region/County: | Metn District | Coord. Source: | |
| Sector: | Bnebil | Coord. Accuracy: | |
| Exact Site: | LBN-Bnebil | Elevation: | 1000 |
| Habitat: | 1. Forest & Woodland|1.4. Temperate Forest | Elevation Accuracy: | |
| Latitude: | 33.90016 | Depth: | |
| Longitude: | 35.736343 | Depth Accuracy: | |
| Sampling Protocol: | Malaise Trap | ||
| Collectors: | Magda Bou Dagher Kharrat | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Mediterranean_Forest_Woodlands_&_Scrub_simplify-0.001_buffered-0.018 |
| Ecoregion: | Eastern_Mediterranean_conifer-broadleaf_forests |
http://portal.boldsystems.org/record/GMLBA11083-23 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGMLBA11083-23&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGMLBA11083-23&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXL39XFyNDQ0sDDWNTK2zsnMzSxJTQEA2QYLlg==?length=1
© 2024 BOLDSYSTEMS