| Sequence ID: | GRAEL4425-23.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| TTTATATTTTATTTTCGGAATTTGAGCTGGTATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAACTGATTAATCCCATTAATACTTGGAGCCCCAGATATAGCTTTCCCTCGTATAAATAATATAAGTTTCTGACTTCTCCCCCCTTCCTTAACTCTTCTTATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATCTAGCCATTTTTTCATTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATTAATATACGTTTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCCTTTCTCTTATTACTATCTTTACCAGTTTTAGCTGGAGCTATTACAATATTACTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATATCAACATTTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 653 bp | ||
| Sequence Upload Date: | 2023-09-13 | ||
| Specimen Depository: | Research Collection of Carlos Lopez-Vaamonde |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Jules Dessart-Pardon |
| Collectors: | Carlos Lopez Vaamonde |
| Specimen Identification: | Carlos Lopez-Vaamonde |
| Process ID: | GRAEL4425-23 | Sample ID: | CLV45181 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2023-04-17 | Museum ID: | ||||
| Collection Code: | Field ID: | CLV45181 | ||||
| Deposited In: | Research Collection of Carlos Lopez-Vaamonde | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 69c5d7a071b875372ce8a5e888a448fc | |||||
| Kingdom: | Animalia | Subfamily: | Boletobiinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Eublemma |
| Order: | Lepidoptera | Species: | Eublemma candidana |
| Family: | Erebidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAL4751 | Subspecies: | |
| Identification Method: | Morphology | ||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Leg | Sex: | |
| Brief Note: | Life Stage: | Adult | |
| Detailed Notes: | |||
| Country/Ocean: | France (FR) | Collection Date Start: | 2022-08-17 |
|---|---|---|---|
| Province/State: | Pays de la Loire | Collection Date End: | |
| Region/County: | Vendee | Coord. Source: | |
| Sector: | Olonne-sur-Mer | Coord. Accuracy: | |
| Exact Site: | dunes plage des Granges | Elevation: | 4 |
| Habitat: | coastal dunes | Elevation Accuracy: | |
| Latitude: | 46.585 | Depth: | |
| Longitude: | -1.842 | Depth Accuracy: | |
| Sampling Protocol: | skinner actinic 20W | ||
| Collectors: | Carlos Lopez Vaamonde | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | Temperate_Broadleaf_&_Mixed_Forest_simplify-0.001_buffered-0.018 |
| Ecoregion: | European_Atlantic_mixed_forests |
http://portal.boldsystems.org/record/GRAEL4425-23 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGRAEL4425-23&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGRAEL4425-23&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIPcnT1MTExMtU1MrbOyczNLElNAQDPvQtw?length=1
© 2024 BOLDSYSTEMS