| Sequence ID: | GWOSM016-11.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | MLepF1 (GCTTTCCCACGAATAAATAATA) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| TAAGATTTTGATTATTACCTCCTTCTATTACTCTCTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACGGTTTACCCACCTTTATCATCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTCTCCTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTGTTTGATCAGTAGGTATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGAGGTGACCCTATTCTCTATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 407 bp | ||
| Sequence Upload Date: | 2011-06-09 | ||
| Specimen Depository: | Research Collection of Bernd Mueller |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | ZSM Photography Team |
| Collectors: | B. Mueller |
| Specimen Identification: | Bernd Mueller |
| Process ID: | GWOSM016-11 | Sample ID: | BMB Lep 00116 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2011-04-08 | Museum ID: | BMB Lep 00116 | |||
| Collection Code: | BMB Lepidoptera | Field ID: | BMB Lep 00116 | |||
| Deposited In: | Research Collection of Bernd Mueller | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 46e115f4c3ba0fea55b9e199d932d366 | |||||
| Kingdom: | Animalia | Subfamily: | Ennominae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Boarmiini |
| Class: | Insecta | Genus: | Selidosema |
| Order: | Lepidoptera | Species: | Selidosema brunnearia |
| Family: | Geometridae | Scientific Name Authorship: | Villers, 1789 |
| BIN ID: | BOLD:ACE5955 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Germany (DE) | Collection Date Start: | 1985-08-10 |
|---|---|---|---|
| Province/State: | Saxony | Collection Date End: | |
| Region/County: | Hoyerswerda | Coord. Source: | |
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Burghammer vic. | Elevation: | 110 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 51.48333 | Depth: | |
| Longitude: | 14.36667 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | B. Mueller | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Central_European_mixed_forests |
http://portal.boldsystems.org/record/GWOSM016-11 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGWOSM016-11&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGWOSM016-11&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIP9w_2NTA00zU0tM7JzM0sSU0BAMenC1c=?length=1
© 2024 BOLDSYSTEMS