| Sequence ID: | GWOUI233-21.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCACACGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCTTTAATATTAGGAGCACCAGATATAGCATTTCCCCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCATTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGATCAGTAGATCTTGCTATTTTCTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTCGATCAAATACCATTATTTATTTGAGCAGTAGGAATTACTGCATTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTCTTTGATCCAGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2021-12-17 | ||
| Specimen Depository: | Research Collection of Stanislav Korb |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | S Korb |
| Collectors: | S. Korb |
| Specimen Identification: | S. Korb |
| Process ID: | GWOUI233-21 | Sample ID: | BC ZSM Lep 114574 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2021-11-26 | Museum ID: | 2021-2A | |||
| Collection Code: | RCSK | Field ID: | BC ZSM Lep 114574 | |||
| Deposited In: | Research Collection of Stanislav Korb | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 15755d5e7d5d00912eef3bebf4bf76a9 | |||||
| Kingdom: | Animalia | Subfamily: | Noctuinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Noctuini |
| Class: | Insecta | Genus: | Chersotis |
| Order: | Lepidoptera | Species: | |
| Family: | Noctuidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AEN9868 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | M | |
| Brief Note: | Life Stage: | a | |
| Detailed Notes: | X | ||
| Country/Ocean: | Kyrgyzstan (KG) | Collection Date Start: | 2011-07-14 |
|---|---|---|---|
| Province/State: | Naryn | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Moldo-Too Mts., Koro-Goo Pass | Elevation: | 2000 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 41.526 | Depth: | |
| Longitude: | 74.652 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | S. Korb | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Tian_Shan_foothill_arid_steppe |
http://portal.boldsystems.org/record/GWOUI233-21 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AGWOUI233-21&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AGWOUI233-21&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsXIP9w_1NDI21jUytM7JzM0sSU0BAMenC1c=?length=1
© 2024 BOLDSYSTEMS