| Sequence ID: | HEANT134-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Canadian Centre for DNA Barcoding | ||
| ATTATACTTTATTTTCGGAATATGAGCAGGAATAGTGGGATCAGCTATAAGAGTAATTATTCGTATTGAGCTAGGACAACCTGGAAGATTCATTGGAGATGATCAAATTTATAACGTAGTAGTAACTGCTCACGCATTTATCATAATCTTTTTTATAGTAATACCAATTATAATTGGTGGGTTTGGTAACTGATTAGTCCCTTTAATAATTGGGGCTCCCGATATAGCATTTCCTCGAATAAATAATATAAGATTCTGATTGCTACCACCCTCATTAACATTACTAATAATAAGAAGCCTCGCAGAATCTGGGGCAGGAACTGGTTGAACTGTTTACCCACCTTTATCAAGAAATCTAGCCCATAGAGGAGCATCTGTTGATTTAGCAATCTTTTCACTACATTTAGCAGGGGTGTCATCAATTCTAGGGGCAGTAAACTTTATTTCAACGATCATTAATATACGGCCAATAGGAATAACTCCTGAACGTATCCCTTTATTCGTATGATCAGTAGGAATTACAGCTCTCCTATTATTATTATCCCTTCCAGTATTAGCTGGAGCTATCACTATACTATTGACCGACCGTAATTTTAACACATCATTCTTTGACCCATCAGGAGGTGGGGATCCTATTCTATACCAACATTTAT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 653 bp | ||
| Sequence Upload Date: | 2022-03-15 | ||
| Specimen Depository: | Research Collection of Roland Lupoli |
|---|---|
| Sequencing Center: | Canadian Centre for DNA Barcoding |
| Photography: | Roland Lupoli |
| Collectors: | Roland Lupoli |
| Specimen Identification: | Roland Lupoli |
| Process ID: | HEANT134-22 | Sample ID: | RL-PENT-163 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-01-25 | Museum ID: | ||||
| Collection Code: | Field ID: | RL-PENT-163 | ||||
| Deposited In: | Research Collection of Roland Lupoli | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | b0bb5e237cd8f740cefad67ad8c4ec40 | |||||
| Kingdom: | Animalia | Subfamily: | Pentatominae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | Carpocorini |
| Class: | Insecta | Genus: | Carpocoris |
| Order: | Hemiptera | Species: | Carpocoris fuscispinus |
| Family: | Pentatomidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AEI2178 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | Spain (ES) | Collection Date Start: | 2021-06-14 |
|---|---|---|---|
| Province/State: | Andalusia | Collection Date End: | |
| Region/County: | Coord. Source: | ||
| Sector: | Maria | Coord. Accuracy: | |
| Exact Site: | Parc Sierra Maria | Elevation: | 1030 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | Roland Lupoli | ||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/HEANT134-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AHEANT134-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AHEANT134-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJwdfQLMTQ20TUyss7JzM0sSU0BAMXECz0=?length=1
© 2024 BOLDSYSTEMS