| Sequence ID: | LEASZ459-22.COI-5P | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACTTTATATTTTATTTTCGGAATTTGATCAGGAATAGTTGGTACTTCATTAAGTCTTTTAATTCGAGCCGAATTAGGAACGCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACTGGACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATGGCATTTCCACGAATAAATAATATAAGATTTTGACTACTACCCCCCTCTCTTACATTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCTCCATTATCATCTAATATTGCTCATAGTGGAAGATCAGTAGATCTTGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATAAAATTAAATGGATTATCATTTGATCAAATACCCTTATTTGTATGAGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCTCTACCAGTTTTAGCTGGAGCAATCACTATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2022-08-11 | ||
| Specimen Depository: | Tiroler Landesmuseum Ferdinandeum |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | |
| Collectors: | Huemer P. |
| Specimen Identification: | Peter Huemer |
| Process ID: | LEASZ459-22 | Sample ID: | TLMF Lep 32947 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-07-11 | Museum ID: | 2784904 | |||
| Collection Code: | TLMF | Field ID: | ||||
| Deposited In: | Tiroler Landesmuseum Ferdinandeum | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 3ec8542c76867bc7e0b30d722e4c2f56 | |||||
| Kingdom: | Animalia | Subfamily: | Phycitinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Isauria |
| Order: | Lepidoptera | Species: | Isauria dilucidella |
| Family: | Pyralidae | Scientific Name Authorship: | |
| BIN ID: | BOLD:AAV2754 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | leg | Sex: | |
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Kyrgyzstan (KG) | Collection Date Start: | 2022-06-22 |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Chuy Oblasti | Coord. Source: | |
| Sector: | Coord. Accuracy: | 100 | |
| Exact Site: | North Tian-Shan, Alexander Mountains, near Bishkek (K78) | Elevation: | 1060 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 42.775 | Depth: | |
| Longitude: | 74.534 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Huemer P. | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Tian_Shan_foothill_arid_steppe |
http://portal.boldsystems.org/record/LEASZ459-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ALEASZ459-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ALEASZ459-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJxdQyOMjG11DUyss7JzM0sSU0BAMc6C1Y=?length=1
© 2024 BOLDSYSTEMS