| Sequence ID: | LIMW4213-22.ITS | GenBank Accession: | |
|---|---|---|---|
| Primers Forward: | Primers Reverse: | ||
| Sequence Run Site: | Unknown | ||
| tcttggtcatttagaggaagtaaaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattaccgagagggatgtgcgccttgcggccacgtcccggggggttgcgcccccatctcatcaacccttgcctatctacctctgttgcttcggcgagcgcccgggtgctttgcgcccgggccccggcctcggtcggtgcggtctcgccggaggccaacttgaacctgtctgtagggtcgtctgagtgtaccgattaaaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccccctggtattccggggggcatgcctgttcgagcgtcattgtaacctcaagctttgcttggtcttgggcgttcgcgtccccgctcccggggatgcgtgcccgtaaatcagtggcggtccggggggactttaagcgcagtagtatctatccgcttcagaggtctcgcctctggcccggctattaaacccccaatgtccaatgattgacctcgg | |||
| Locus: | ITS | ||
| Nucleotides: | 595 bp | ||
| Sequence Upload Date: | 2022-09-21 | ||
| Specimen Depository: | Brigham Young University, Herbarium of Non-Vascular Cryptogams |
|---|---|
| Sequencing Center: | Unknown |
| Photography: | |
| Collectors: | |
| Specimen Identification: |
| Process ID: | LIMW4213-22 | Sample ID: | S._Leavitt_19-059 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2022-09-21 | Museum ID: | sl19059 | |||
| Collection Code: | Field ID: | |||||
| Deposited In: | Brigham Young University, Herbarium of Non-Vascular Cryptogams | |||||
| Associated Datasets: | ||||||
| Specimen Linkout: | ||||||
| Checksum: | 494cf897182a02fd94adaf433ac779c9 | |||||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | |||
| Country/Ocean: | United States (US) | Collection Date Start: | |
|---|---|---|---|
| Province/State: | Collection Date End: | ||
| Region/County: | Coord. Source: | ||
| Sector: | Coord. Accuracy: | ||
| Exact Site: | Elevation: | ||
| Habitat: | Elevation Accuracy: | ||
| Latitude: | Depth: | ||
| Longitude: | Depth Accuracy: | ||
| Sampling Protocol: | |||
| Collectors: | |||
| Collection Note: | |||
| Realm: | |
|---|---|
| Biome: | |
| Ecoregion: |
http://portal.boldsystems.org/record/LIMW4213-22 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ALIMW4213-22&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ALIMW4213-22&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfLx9A03MTI01jUyss7JzM0sSU0BAMW8Czg=?length=1
© 2024 BOLDSYSTEMS