| Sequence ID: | LNOUC449-10.COI-5P | GenBank Accession: | JF855562 |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACTTTATATTTTATTTTTGGTATTTGATCCGGAATAGTTGGGACATCTTTAAGATTACTAATTCGGGCTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCCGATATAGCATTCCCTCGACTTAATAATATAAGATTTTGATTACTACCCCCCTCATTAATCCTATTAATTTCAAGAAGAGTAGTAGAAAATGGAGCAGGAACTGGATGAACTGTCTATCCCCCCCTTTCTTCCAATATTGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAACTTTATTACAACCATTATTAATATACGACCTAACGGAATAAAATTTGATAGTATACCTTTATTTGTCTGATCTGTATTAATTACAGCTATTTTATTATTACTATCTTTACCTGTATTGGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACTTCCTTTTTTGACCCGGCAGGAGGGGGGGACCCAATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2011-03-04 | ||
| Specimen Depository: | Research Collection of Helmut Deutsch |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | David C. Lees |
| Collectors: | Helmut Deutsch |
| Specimen Identification: | Jean-Francois Landry |
| Process ID: | LNOUC449-10 | Sample ID: | CLV1513 | |||
|---|---|---|---|---|---|---|
| Record Created: | 2010-11-29 | Museum ID: | ||||
| Collection Code: | Field ID: | CLV1513 | ||||
| Deposited In: | Research Collection of Helmut Deutsch | |||||
| Associated Datasets: |
DS-EUGRACI2 | European Gracillariidae updated DS-LEATYROL | Lepidoptera of the Alps - Tyrol DS-MARKALL | Dataset for 41583 records of European Lepidoptera |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 715157cc9b28061a5115c9239d4e9f6e | |||||
| Kingdom: | Animalia | Subfamily: | Parornichinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Parornix |
| Order: | Lepidoptera | Species: | Parornix anglicella |
| Family: | Gracillariidae | Scientific Name Authorship: | Stainton, 1850 |
| BIN ID: | BOLD:ABZ6947 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | S | |
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | A | |
| Detailed Notes: | |||
| Country/Ocean: | Austria (AT) | Collection Date Start: | 2005-05-03 |
|---|---|---|---|
| Province/State: | Tyrol | Collection Date End: | |
| Region/County: | Osttirol | Coord. Source: | |
| Sector: | Doelsach | Coord. Accuracy: | |
| Exact Site: | Goertschacher Berg | Elevation: | 875 |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 46.81 | Depth: | |
| Longitude: | 12.859 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | Helmut Deutsch | ||
| Collection Note: | |||
| Realm: | Palearctic |
|---|---|
| Biome: | |
| Ecoregion: | Alps_conifer_and_mixed_forests |
http://portal.boldsystems.org/record/LNOUC449-10 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3ALNOUC449-10&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3ALNOUC449-10&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfLx8w91NjGx1DU0sM7JzM0sSU0BAMdoC1Q=?length=1
© 2024 BOLDSYSTEMS