| Sequence ID: | MEC224-04.COI-5P | GenBank Accession: | GU095589 |
|---|---|---|---|
| Primers Forward: | LepF1 (ATTCAACCAATCATAAAGATATTGG) | Primers Reverse: | LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) |
| Sequence Run Site: | Centre for Biodiversity Genomics | ||
| AACTTTATATTTTATTTTTGGAATTTGATCGGGAATATTAGGAACATCATTAAGTATATTAATTCGAGCTGAACTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCATTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAACTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGATTAAATAATATAAGATTTTGATTATTACCCCCCTCTTTAATTTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCAATTTTCTCATTACATTTAGCTGGAATTTCATCAATTCTTGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGCTAACGGAATAATATTTGATAGTATATCATTATTTACTTGAGCTGTAAGTATTACTGCTTTACTTTTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACAATATTATTAACTGATCGAAATTTAAACACTTCATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT | |||
| Locus: | COI-5P | ||
| Nucleotides: | 658 bp | ||
| Sequence Upload Date: | 2005-08-26 | ||
| Specimen Depository: | Canadian National Collection of Insects, Arachnids and Nematodes |
|---|---|
| Sequencing Center: | Centre for Biodiversity Genomics |
| Photography: | Jean-Francois Landry |
| Collectors: | J.F. Landry |
| Specimen Identification: |
| Process ID: | MEC224-04 | Sample ID: | jflandry0224 | |||
|---|---|---|---|---|---|---|
| Record Created: | Museum ID: | CNC LEP 00003459 | ||||
| Collection Code: | Field ID: | |||||
| Deposited In: | Canadian National Collection of Insects, Arachnids and Nematodes | |||||
| Associated Datasets: |
DS-COIALGA1 | IRMAWATI Mamiellaceae COI 5P DS-EASTNA1 | DNA barcodes for 1/1000 of the animal kingdom DS-LEPNA1 | Lepidoptera North America |
|||||
| Specimen Linkout: | ||||||
| Checksum: | 72f397eb88e2ab50733e7fcd1b9b1d25 | |||||
| Kingdom: | Animalia | Subfamily: | Gracillariinae |
|---|---|---|---|
| Phylum: | Arthropoda | Tribe: | |
| Class: | Insecta | Genus: | Caloptilia |
| Order: | Lepidoptera | Species: | Caloptilia alnivorella |
| Family: | Gracillariidae | Scientific Name Authorship: | Chambers, 1875 |
| BIN ID: | BOLD:AAB7939 | Subspecies: | |
| Identification Method: | |||
| Taxonomy Notes: | |||
| * Barcode Index Numbers (BIN): Clustered barcode sequences that create OTUs (operational taxonomic units) closely reflective of species groupings | |||
| Voucher Status: | Reproduction: | ||
|---|---|---|---|
| Tissue Descriptor: | Sex: | ||
| Brief Note: | Life Stage: | ||
| Detailed Notes: | at blacklight | ||
| Country/Ocean: | Canada (CA) | Collection Date Start: | 2004-05-14 |
|---|---|---|---|
| Province/State: | Quebec | Collection Date End: | |
| Region/County: | Pontiac | Coord. Source: | |
| Sector: | Eardley | Coord. Accuracy: | |
| Exact Site: | petite colline near Eardley-Masham Road | Elevation: | |
| Habitat: | Elevation Accuracy: | ||
| Latitude: | 45.5665 | Depth: | |
| Longitude: | -76.0933 | Depth Accuracy: | |
| Sampling Protocol: | |||
| Collectors: | J.F. Landry | ||
| Collection Note: | |||
| Realm: | Nearctic |
|---|---|
| Biome: | |
| Ecoregion: | Eastern_Canadian_Forest-Boreal_transition |
http://portal.boldsystems.org/record/MEC224-04 http://fastapi-app:8000/api/summary?query=ids%3Aprocessid%3AMEC224-04&fields=marker_code http://fastapi-app:8000/api/query?query=ids%3Aprocessid%3AMEC224-04&extent=limited http://fastapi-app:8000/api/documents/eAHLTCm2KijKT04tLs5MsfJ1dTYyMtE1MLHOyczNLElNAQCvzAqi?length=1
© 2024 BOLDSYSTEMS